Euxoa culminicola

Staudinger, 1870 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records963

Data sources7

Biological traits0

DNA specimens11

eDNA detections11

Sources7 archives

Databases and archives Euxoa culminicola's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility963 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF963 records

Environmental DNA1 datasets · 3 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Euxoa culminicola is a moth of the family Noctuidae. It is found in the Alps and Pyrenees in Austria, France, Italy, Spain and Switzerland. The wingspan is 39–43 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa culminicola has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections11

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

172Cvariable

616Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa lucidasame genus1.8%Euxoa comosasame genus1.8%Euxoa fumalissame genus2.4%Euxoa occidentalissame genus2.6%Euxoa mendelissame genus2.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type963 records

Wild obs. + sensor473

Museum / vouchered462

Other28

Origin

Native351

Range

Area of Occupancy AOO788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 17≤1 km 123≤10 km 314>10 km 2

456 georeferenced · 17 without coordinates

Open the mapobservation + sensor473

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤1 km 86≤10 km 356>10 km 9

451 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence462

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SFRAlocation not on record	67
Provincia di Livornolocation not on record	62
Glarus, CH	55
Zürich, CH	53
Geneva, CH	24
Salzburg, AT	14
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	10
Fribourg, CH	10
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	10
John May Museum of Natural Historylocation not on record	9
Bern, CH	8
Sion, CH	8
Archäologie und Museum Baselland - Museum.BLlocation not on record	8
Frauenfeld, CH	8
Dhaka, BD	7
Musee d'Histoire Naturallelocation not on record	6
EGBlocation not on record	6
Universität Zürich, Naturhistorisches Museumlocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Tartu, EE	2
Philadelphia, US	1
UMUlocation not on record	1
Winterthur, CH	1

24 institutions · 380 of 462 vouchered records shown · 82 without an institution code

09Environmental DNA11 detections

Where the DNA of Euxoa culminicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.70 °C 4.40–16.2

Seasonal swing summer↔winter20.4 °C

Max temp (day)12.0 °C 8.60–20.4

Min temp (night)1.40 °C -1.80–10.0

Precipitation119 mm/mo 72.7–220

Air humidity58.1 % 56.5–64.3

Moisture balance3.00 mm/mo -74.5–108

Vapour deficit447 Pa 334–795

Wind speed6.40 m/s 3.10–8.00

Cloud cover37.3 % 35.8–38.0

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)