Euxoa comosa

Morrison, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records740

Data sources7

Biological traits0

DNA specimens169

eDNA detections229

Sources7 archives

Databases and archives Euxoa comosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility740 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI229 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics169 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF740 records

Environmental DNA1 datasets · 2 countries229 detections

DNA & barcodingBOLD169 specimens

01Narrative

Euxoa comosa, the hairy euxoa moth, is a moth of the family Noctuidae first described by Herbert Knowles Morrison in 1876. It is found in western North America, except the Pacific coast, ranging east through the northern Great Plains, and in the Hudsonian zone to the Atlantic Ocean. It is found in every province and territory of Canada, except Nunavut. The wingspan is about 32 mm. Larvae have been recorded on Secale cereale.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding169 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa comosa has left across the world's sequence archives.

At a glance

DNA specimens169

BINs3

Marker genes1

eDNA detections229

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus157 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

52Amostly conserved

59Cmostly conserved

79Gmostly conserved

82Tmostly conserved

85Tmostly conserved

106Tmostly conserved

127Tmostly conserved

172Tmostly conserved

187Cmostly conserved

217Gmostly conserved

220Cvariable

232Amostly conserved

319Amostly conserved

361Cvariable

418Tmostly conserved

479Tmostly conserved

506Amostly conserved

547Cmostly conserved

550Amostly conserved

571Cmostly conserved

580Tmostly conserved

646Tvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGGAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 51 variants.

Diversity (π)1.3%

Haplotypes51

BINs3

Most divergent pair3.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa culminicolasame genus1.8%Euxoa maimessame genus2.1%Euxoa nomassame genus2.1%Euxoa taurasame genus2.3%Euxoa aberranssame genus2.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type740 records

Wild obs. + sensor141

Museum / vouchered599

Range

Area of Occupancy AOO1 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 89≤1 km 13≤10 km 20>10 km 2

124 georeferenced · 17 without coordinates

Open the mapobservation + sensor141

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 63≤1 km 12≤10 km 60>10 km 5

140 georeferenced · 459 without coordinates

Open the institutions mapphysical evidence599

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	220
New Haven, US	54
Vernal, US	37
Colorado State Universitylocation not on record	33
Royal Saskatchewan Museumlocation not on record	25
Edmonton, CA	24
Oregon State Arthropod Collectionlocation not on record	24
St. Paul, US	14
Denver, US	13
East Lansing, US	8
Helsinki, FI	7
Albuquerque, US	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
WWUlocation not on record	5
San Francisco, US	2
ASUlocation not on record	2
Philadelphia, US	1
University of Guelphlocation not on record	1

18 institutions · 481 of 599 vouchered records shown · 118 without an institution code

09Environmental DNA229 detections

Where the DNA of Euxoa comosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found229

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 229 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland|1.4. Temperate ForestMixed HabitatGrassland1. Forest & Woodland | 1.4. Temperate Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 12.3–25.6

Seasonal swing summer↔winter23.5 °C

Max temp (day)24.7 °C 19.2–32.7

Min temp (night)11.0 °C 6.20–19.4

Precipitation27.1 mm/mo 4.20–82.3

Air humidity51.5 % 39.4–56.1

Moisture balance-106 mm/mo -161–-32.7

Vapour deficit1,010 Pa 661–1,741

Wind speed3.00 m/s 1.70–4.40

Cloud cover32.0 % 9.90–39.5

CHELSA 1981–2010, ~9 km grid, at location & month of 186 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)