Eutolmus rufibarbis

(Meigen, 1820) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Asilidae/Eutolmus

At a glance

Occurrence records13 607

Data sources9

Biological traits2

DNA specimens34

eDNA detections27

Sources9 archives

Databases and archives Eutolmus rufibarbis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 607 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF13 607 records

Environmental DNA1 datasets · 2 countries27 detections

DNA & barcodingBOLD34 specimens

Genome at a glanceGoaT · NCBI≈286 Mbp

01Narrative

Eutolmus rufibarbis is a Palearctic species of robber fly in the family Asilidae. Verrall, G. H., 1909 Stratiomyidae and succeeding families of the Diptera Brachycera of Great Britain British flies Volume 5 London : Gurney and Jackson, 1909.BHL Full text with illustrations

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eutolmus rufibarbis has left across the world's sequence archives.

At a glance

DNA specimens34

BINs3

Marker genes1

eDNA detections27

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

22Amostly conserved

31Tvariable

49Avariable

100Tmostly conserved

178Cvariable

232Gvariable

254Amostly conserved

259Tvariable

273Cmostly conserved

277Tmostly conserved

346Tvariable

347Tvariable

421Amostly conserved

473Gvariable

484Cvariable

496Gvariable

502Gvariable

514Cvariable

544Avariable

565Avariable

625Amostly conserved

AACCCTTTATTTCTTATTCGGAGCATGAGCTGGAATAGTAGGAACCTCATTAAGACTACTAATTCGAGCAGAACTAGGACATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes6

BINs3

Most divergent pair8.4%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Machimus notatussame family13.4%Machimus sadyatessame family13.7%Synolcus dubiussame family14.2%Neoitamus cyanurussame family14.3%Didysmachus picipessame family14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Eutolmus rufibarbis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈285 920 159 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Eutolmus rufibarbis0.29 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.4% BUSCO

08Occurrence & distribution

Record type13 607 records

Wild obs. + sensor13 159

Museum / vouchered448

Range

Area of Occupancy AOO11 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy19% within 1 km

≤100 m 1 521≤1 km 651≤10 km 9 259>10 km 17

11 448 georeferenced · 1 711 without coordinates

Open the mapobservation + sensor13 159

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 73≤1 km 107≤10 km 67

247 georeferenced · 201 without coordinates

Open the institutions mapphysical evidence448

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	163
Uniwersytet Łódzkilocation not on record	117
SLU Artdatabankenlocation not on record	74
Tilburg, NL	27
Stockholm, SE	24
NHMOlocation not on record	9
Gothenburg, SE	5
South Kensington, GB	4
Copenhagen, DK	4
Fredericton Stock Culture Collectionlocation not on record	3
Natural History Museum Rotterdamlocation not on record	3
Chiba, JP	2
Helsinki, FI	2
Ghent, BE	1
BioFokuslocation not on record	1
Philadelphia, US	1
CBDClocation not on record	1
neflocation not on record	1
Natural History Museum, Londonlocation not on record	1

19 institutions · 443 of 448 vouchered records shown · 5 without an institution code

09Environmental DNA27 detections

Where the DNA of Eutolmus rufibarbis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 17.1–18.5

Seasonal swing summer↔winter12.8 °C

Max temp (day)21.1 °C 20.9–22.8

Min temp (night)12.8 °C 12.8–13.6

Precipitation59.7 mm/mo 52.4–65.4

Air humidity60.3 % 57.9–60.6

Moisture balance-70.2 mm/mo -76.2–-67.9

Vapour deficit781 Pa 766–903

Wind speed4.00 m/s 3.60–4.10

Cloud cover43.0 % 38.2–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eutolmus rufibarbis

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type13 607 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type13 607 records