Neoitamus cyanurus

(Loew, 1849) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Asilidae/Neoitamus

At a glance

Occurrence records17 926

Data sources8

Biological traits2

DNA specimens30

eDNA detections464

Sources8 archives

Databases and archives Neoitamus cyanurus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 926 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI464 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF17 926 records

Environmental DNA5 datasets · 9 countries464 detections

DNA & barcodingBOLD30 specimens

Genome at a glanceGoaT · NCBI≈365 Mbp

01Narrative

Neoitamus cyanurus, the common awl robberfly, is a species of 'robber fly' belonging to the family Asilidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neoitamus cyanurus has left across the world's sequence archives.

At a glance

DNA specimens30

BINs3

Marker genes2

eDNA detections464

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

13Cmostly conserved

28Gmostly conserved

58Gmostly conserved

67Amostly conserved

91Cmostly conserved

94Gmostly conserved

109Amostly conserved

220Tmostly conserved

232Tmostly conserved

235Tvariable

256Cmostly conserved

268Cmostly conserved

271Tmostly conserved

313Cmostly conserved

334Amostly conserved

343Gmostly conserved

367Tmostly conserved

382Tmostly conserved

386Tmostly conserved

394Tmostly conserved

415Amostly conserved

418Tmostly conserved

433Gmostly conserved

442Tmostly conserved

454Cmostly conserved

472Tmostly conserved

475Cmostly conserved

487Cmostly conserved

502Cmostly conserved

550Tmostly conserved

553Tmostly conserved

557Tmostly conserved

571Cmostly conserved

580Cmostly conserved

598Amostly conserved

604Tmostly conserved

619Gmostly conserved

634Tmostly conserved

640Tmostly conserved

641Tmostly conserved

AACTCTATACTTCGTATTCGGAGCATGGGCAGGAATAGTAGGAACATCACTAAGACTGCTAATTCGATCAGAACTAGGACACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes9

BINs3

Most divergent pair10.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neoitamus sociussame genus10.2%Antipalus varipessame family14.3%Clistoabdominalis nitidifronssame order15.1%Clinocera disjunctasame order15.4%Dolichopus virgasame order15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Neoitamus cyanurus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈365 493 643 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Neoitamus cyanurus0.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.2% BUSCO

08Occurrence & distribution

Record type17 926 records

Wild obs. + sensor17 212

Museum / vouchered714

Range

Area of Occupancy AOO17 140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 2 303≤1 km 1 067≤10 km 11 656>10 km 16

15 042 georeferenced · 2 170 without coordinates

Open the mapobservation + sensor17 212

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 143≤1 km 206≤10 km 172>10 km 1

522 georeferenced · 192 without coordinates

Open the institutions mapphysical evidence714

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	218
Tilburg, NL	129
NHMOlocation not on record	63
SLU Artdatabankenlocation not on record	58
Copenhagen, DK	58
Stockholm, SE	28
Helsinki, FI	16
Washington, US	13
CBDClocation not on record	12
NEFlocation not on record	12
University of Tokyo, Department of Zoologylocation not on record	11
BioFokuslocation not on record	8
South Kensington, GB	6
neflocation not on record	5
NMOKlocation not on record	5
Natural History Museum Rotterdamlocation not on record	5
Gothenburg, SE	5
ZMAAlocation not on record	4
DFFW2018location not on record	4
SGAV-and-NHMDlocation not on record	4
DFlocation not on record	3
Provincia di Livornolocation not on record	3
NCMGlocation not on record	2
Natural History Museum, Londonlocation not on record	2
Kuopio, FI	2
Tallinn, EE	2
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1
DFFW2016location not on record	1
Tromsø, NO	1

30 institutions · 682 of 714 vouchered records shown · 32 without an institution code

09Environmental DNA464 detections

Where the DNA of Neoitamus cyanurus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found464

Studies independent surveys5

Countries9

Verifiable raw sequence linked426

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 464 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 13.4–17.2

Seasonal swing summer↔winter17.5 °C

Max temp (day)18.7 °C 17.2–20.8

Min temp (night)10.8 °C 9.20–13.6

Precipitation71.3 mm/mo 57.3–92.1

Air humidity60.5 % 58.3–61.5

Moisture balance-43.1 mm/mo -66.1–-15.0

Vapour deficit667 Pa 610–772

Wind speed3.70 m/s 2.50–4.30

Cloud cover45.1 % 39.8–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 463 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Neoitamus cyanurus

At a glance

Sources8 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type17 926 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type17 926 records