Euschistus obscurus

(Palisot, 1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Euschistus

At a glance

Occurrence records1 009

Data sources6

Biological traits0

DNA specimens13

eDNA detections13

Sources6 archives

Databases and archives Euschistus obscurus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 009 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 009 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Euschistus obscurus, the pale-lined stink bug, is a species of stink bug in the family Pentatomidae. It is found in the Caribbean Sea, Central America, and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euschistus obscurus has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 107 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

4Amostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Cmostly conserved

13Cmostly conserved

14Cmostly conserved

15Tmostly conserved

17Tmostly conserved

19Tmostly conserved

20Gmostly conserved

23Amostly conserved

24Tmostly conserved

25Amostly conserved

26Tmostly conserved

29Gmostly conserved

30Cmostly conserved

31Tmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

36Tmostly conserved

38Gmostly conserved

39Tmostly conserved

40Amostly conserved

42Gmostly conserved

43Amostly conserved

44Tmostly conserved

45Cmostly conserved

46Cmostly conserved

47Gmostly conserved

48Cmostly conserved

49Tmostly conserved

52Amostly conserved

54Gmostly conserved

55Amostly conserved

59Amostly conserved

60Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Tmostly conserved

68Amostly conserved

70Tmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

80Cmostly conserved

81Amostly conserved

83Cmostly conserved

84Cmostly conserved

85Amostly conserved

106Tvariable

154Cmostly conserved

160Gmostly conserved

163Amostly conserved

169Tmostly conserved

181Gmostly conserved

184Tmostly conserved

196Gvariable

197Cmostly conserved

205Cmostly conserved

217Amostly conserved

265Cmostly conserved

266Tmostly conserved

268Amostly conserved

274Tmostly conserved

298Tmostly conserved

301Amostly conserved

316Gmostly conserved

340Tmostly conserved

343Cmostly conserved

346Tmostly conserved

358Cmostly conserved

367Cmostly conserved

373Amostly conserved

397Tmostly conserved

407Cmostly conserved

409Amostly conserved

412Tmostly conserved

418Cmostly conserved

421Tmostly conserved

427Cmostly conserved

428Tmostly conserved

442Cvariable

445Cmostly conserved

460Cmostly conserved

466Gmostly conserved

478Gmostly conserved

499Tmostly conserved

511Amostly conserved

523Tvariable

535Amostly conserved

544Amostly conserved

548Tmostly conserved

550Amostly conserved

557Tmostly conserved

562Amostly conserved

565Amostly conserved

571Tmostly conserved

589Cmostly conserved

595Tmostly conserved

601Cmostly conserved

AACATTATACTTCCTATTTGGAATATGAGCTGGAATAGTAGGATCCGCTATAAGAATTATTATTCGTATTGAATTAGGACAACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.2%

Haplotypes5

BINs2

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euschistus bifibulussame genus11.9%Proxys punctulatussame family13.7%Oechalia schellenbergiisame family13.7%Antestiopsis thunbergiisame family13.8%Chlorochroa sayisame family13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 009 records

Wild obs. + sensor799

Museum / vouchered210

Range

Area of Occupancy AOO2 052 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 453≤1 km 81≤10 km 18>10 km 115

667 georeferenced · 132 without coordinates

Open the mapobservation + sensor799

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 22>10 km 4

26 georeferenced · 184 without coordinates

Open the institutions mapphysical evidence210

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College Station, US	96
Provo, US	46
Chicago, US	41
University of Central Floridalocation not on record	16
Mexico City, MX	3
Durango, MX	2
CUlocation not on record	1
Montgomery, US	1
Lubbock, US	1
Natural History Museum of Utahlocation not on record	1
Los Angeles, US	1
Champaign, US	1

12 institutions · 210 of 210 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Euschistus obscurus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 25.4–26.3

Seasonal swing summer↔winter11.2 °C

Max temp (day)31.0 °C 30.7–31.5

Min temp (night)20.5 °C 20.2–22.2

Precipitation88.2 mm/mo 70.0–195

Air humidity58.2 % 56.9–61.8

Moisture balance-96.3 mm/mo -106–36.7

Vapour deficit1,348 Pa 1,333–1,399

Wind speed2.70 m/s 2.00–3.70

Cloud cover30.0 % 29.5–33.9

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euschistus obscurus

At a glance

Sources6 archives

At a glance

Record type1 009 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 009 records