Proxys punctulatus

(Palisot, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Proxys

At a glance

Occurrence records3 570

Data sources6

Biological traits0

DNA specimens6

eDNA detections13

Sources6 archives

Databases and archives Proxys punctulatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility3 570 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 570 records

Environmental DNA1 datasets · 3 countries13 detections

DNA & barcodingBOLD6 specimens

01Narrative

Proxys punctulatus, the black stink bug, is a species of stink bug in the family Pentatomidae. It is found in the Caribbean Sea, Central America, and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Proxys punctulatus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections13

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.51%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 5 variable positions, in barcode order

166Avariable

463Cvariable

529Tvariable

535Avariable

649Avariable

AACATTATATTTCCTATTCGGTATATGAGCTGGTATAGTAGGATCAGCAATAAGAATAATTATCCGAATTGAATTAGGACAACCCGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Proxys albopunctulatussame genus10.3%Dalpada neoclavatasame family11.2%Padaeus viduussame family11.6%Chalcopis glandulosasame family12.0%Lelia decempunctatasame family12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 570 records

Wild obs. + sensor3 008

Museum / vouchered562

Range

Area of Occupancy AOO8 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 650≤1 km 374≤10 km 131>10 km 351

2 506 georeferenced · 502 without coordinates

Open the mapobservation + sensor3 008

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 3≤1 km 29≤10 km 31>10 km 8

71 georeferenced · 491 without coordinates

Open the institutions mapphysical evidence562

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	302
Provo, US	51
Mississippi State, US	46
University of Central Floridalocation not on record	35
Chicago, US	30
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	20
St. Paul, US	13
Durango, MX	13
Museo Entomologico de Leonlocation not on record	10
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	7
College Station, US	5
University of Guelphlocation not on record	4
Wuzhou, CN	3
San Francisco, US	3
Universidad Nacional de Colombia (UNAL)location not on record	3
Los Angeles, US	3
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
North Carolina State University Insect Museumlocation not on record	2
Ciudad de México, MX	2
Champaign, US	2
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	1
Lubbock, US	1
Universidad del Magdalena (UniMagdalena)location not on record	1
Mexico City, MX	1
CUlocation not on record	1
Australian National Insect Collectionlocation not on record	1

26 institutions · 562 of 562 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Proxys punctulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

14. Artificial - Terrestrial | 14.2 Pasturel…1. Forest & Woodland|1.9. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 23.4–26.2

Seasonal swing summer↔winter2.50 °C

Max temp (day)28.9 °C 26.6–31.2

Min temp (night)21.5 °C 18.8–22.2

Precipitation265 mm/mo 32.0–403

Air humidity63.3 % 59.3–70.8

Moisture balance102 mm/mo -142–264

Vapour deficit1,132 Pa 861–1,381

Wind speed3.40 m/s 1.70–6.40

Cloud cover30.6 % 16.0–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Proxys punctulatus

At a glance

Sources6 archives

At a glance

Record type3 570 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 570 records