Eulepidotis rectimargo

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Eulepidotis

At a glance

Occurrence records997

Data sources5

Biological traits0

DNA specimens175

eDNA detections166

Sources5 archives

Databases and archives Eulepidotis rectimargo's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility997 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI166 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics175 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF997 records

Environmental DNA1 datasets · 8 countries166 detections

DNA & barcodingBOLD175 specimens

01Narrative

Eulepidotis suppura is a moth of the family Erebidae first described by Harrison Gray Dyar Jr. in 1914. It is found in the Neotropics, including Mexico and Venezuela.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding175 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eulepidotis rectimargo has left across the world's sequence archives.

At a glance

DNA specimens175

BINs2

Marker genes4

eDNA detections166

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus164 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

97Cvariable

361Tmostly conserved

400Amostly conserved

407Cvariable

499Cmostly conserved

500Tvariable

616Cmostly conserved

AACTCTATATTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes33

BINs2

Most divergent pair1.7%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eulepidotis electasame genus4.3%Eulepidotis panamensissame genus4.4%Eulepidotis preclarasame genus5.9%Eulepidotis ezrasame genus6.8%Eulepidotis emiliasame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18SWnt1

animal barcoderibosomalmarker

08Occurrence & distribution

Record type997 records

Wild obs. + sensor127

Museum / vouchered870

Range

Area of Occupancy AOO836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 55≤1 km 22≤10 km 10>10 km 4

91 georeferenced · 36 without coordinates

Open the mapobservation + sensor127

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 3≤10 km 4

7 georeferenced · 863 without coordinates

Open the institutions mapphysical evidence870

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	724
Tapachula, MX	52
University of Pennsylvanialocation not on record	4
St. Paul, US	4
Area de Conservacion Guanacastelocation not on record	3
PUC-RSlocation not on record	3
Cambridge, US	2
Universidad de Sucre (UniSucre)location not on record	2
Ciudad de México, MX	2
Colorado State Universitylocation not on record	2
Mississippi State, US	1
MZLUlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

13 institutions · 801 of 870 vouchered records shown · 69 without an institution code

09Environmental DNA166 detections

Where the DNA of Eulepidotis rectimargo was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found166

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 166 detections have coordinates

Open the map8 countries0

1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland | 1.5. Subtropical/Trop…Hill Country1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 22.4–26.2

Seasonal swing summer↔winter2.00 °C

Max temp (day)27.6 °C 25.6–28.7

Min temp (night)23.3 °C 17.6–24.2

Precipitation239 mm/mo 77.5–343

Air humidity68.8 % 65.1–71.2

Moisture balance85.2 mm/mo -74.0–220

Vapour deficit989 Pa 743–1,178

Wind speed3.20 m/s 1.50–4.70

Cloud cover38.6 % 22.0–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 162 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)