Eulepidotis electa

Dyar, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Eulepidotis

At a glance

Occurrence records444

Data sources5

Biological traits0

DNA specimens92

eDNA detections85

Sources5 archives

Databases and archives Eulepidotis electa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility444 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI85 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics92 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF444 records

Environmental DNA1 datasets · 2 countries85 detections

DNA & barcodingBOLD92 specimens

01Narrative

Eulepidotis electa is a moth of the family Erebidae first described by Harrison Gray Dyar Jr. in 1914. It is found in the Neotropics, including Costa Rica and Panama. It has recently been recorded from the US state of Arizona.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding92 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eulepidotis electa has left across the world's sequence archives.

At a glance

DNA specimens92

BINs1

Marker genes3

eDNA detections85

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus80 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

235Cmostly conserved

409Amostly conserved

625Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes12

BIN1

Most divergent pair0.76%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eulepidotis panamensissame genus3.2%Eulepidotis rectimargosame genus4.3%Eulepidotis inclytasame genus5.6%Eulepidotis phrygioniasame genus6.1%Eulepidotis emiliasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18SWnt1

animal barcoderibosomalmarker

08Occurrence & distribution

Record type444 records

Wild obs. + sensor8

Museum / vouchered436

Range

Area of Occupancy AOO352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 2

6 georeferenced · 2 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 436 records without

Open the institutions mapphysical evidence436

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	392
Tapachula, MX	10
University of Pennsylvanialocation not on record	9
Tallinn, EE	2
St. Paul, US	1

5 institutions · 414 of 436 vouchered records shown · 22 without an institution code

09Environmental DNA85 detections

Where the DNA of Eulepidotis electa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found85

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 85 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.5. Subtropical/Trop…1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.2–26.2

Seasonal swing summer↔winter2.40 °C

Max temp (day)27.2 °C 26.3–29.9

Min temp (night)21.7 °C 20.3–24.2

Precipitation274 mm/mo 167–403

Air humidity69.1 % 65.0–70.8

Moisture balance106 mm/mo 32.4–272

Vapour deficit943 Pa 861–1,178

Wind speed3.20 m/s 1.30–4.20

Cloud cover38.7 % 24.5–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 84 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)