Euleia rotundiventris

(Fallén, 1814) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Euleia

At a glance

Occurrence records188

Data sources7

Biological traits2

DNA specimens7

eDNA detections6

Sources7 archives

Databases and archives Euleia rotundiventris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility188 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF188 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD7 specimens

01Narrative

Euleia rotundiventris is a species of tephritid or fruit flies in the genus Euleia of the family Tephritidae.rotundiventris

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euleia rotundiventris has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections6

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.20%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 4 variable positions, in barcode order

98Gmostly conserved

302Gmostly conserved

314Gmostly conserved

412Amostly conserved

TTTATATTTTATTTTTGGTGCTTGAGCCGGAATAGTAGGTACATCACTTAGTATTTTAATTCGAGCTGAACTGGGTCATCCAGGAGCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euleia heracleisame genus3.7%Euleia uncinatasame genus4.0%Euleia fratriasame genus4.0%Trypeta immaculatasame family8.4%Hydrotaea unispinosasame order10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type188 records

Wild obs. + sensor110

Museum / vouchered78

Range

Area of Occupancy AOO472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 54≤1 km 33≤10 km 18

105 georeferenced · 5 without coordinates

Open the mapobservation + sensor110

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 14≤1 km 18≤10 km 29

61 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	46
SLU Artdatabankenlocation not on record	9
South Kensington, GB	9
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	5
University of Tokyo, Department of Zoologylocation not on record	1
Metsähallituslocation not on record	1
ZMAAlocation not on record	1

7 institutions · 72 of 78 vouchered records shown · 6 without an institution code

09Environmental DNA6 detections

Where the DNA of Euleia rotundiventris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.60 °C 7.30–15.6

Seasonal swing summer↔winter19.3 °C

Max temp (day)12.4 °C 11.8–18.5

Min temp (night)6.20 °C 2.00–12.5

Precipitation184 mm/mo 49.8–313

Air humidity62.9 % 60.0–64.2

Moisture balance68.7 mm/mo -68.1–205

Vapour deficit452 Pa 368–720

Wind speed5.10 m/s 2.80–6.40

Cloud cover38.5 % 37.8–40.4

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)