Eubaphe unicolor

(Robinson, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Eubaphe

At a glance

Occurrence records1 139

Data sources8

Biological traits0

DNA specimens32

eDNA detections26

Sources8 archives

Databases and archives Eubaphe unicolor's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 139 records

Environmental DNA1 datasets · 1 countries26 detections

DNA & barcodingBOLD32 specimens

01Narrative

Eubaphe unicolor is a species of geometrid moth in the family Geometridae. It is found throughout North America to South America. The MONA or Hodges number for Eubaphe unicolor is 7444.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eubaphe unicolor has left across the world's sequence archives.

At a glance

DNA specimens32

BINs3

Marker genes1

eDNA detections26

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

1Amostly conserved

46Amostly conserved

88Tmostly conserved

127Tmostly conserved

166Gmostly conserved

178Cmostly conserved

200Gmostly conserved

220Tmostly conserved

223Amostly conserved

266Cmostly conserved

278Tmostly conserved

280Amostly conserved

295Amostly conserved

319Cmostly conserved

352Amostly conserved

368Gmostly conserved

370Amostly conserved

376Cmostly conserved

379Tmostly conserved

397Cmostly conserved

401Tvariable

415Tmostly conserved

466Amostly conserved

490Cmostly conserved

499Amostly conserved

508Tmostly conserved

517Amostly conserved

536Tmostly conserved

538Amostly conserved

547Amostly conserved

559Amostly conserved

568Tmostly conserved

578Cvariable

619Tmostly conserved

634Cmostly conserved

637Amostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes9

BINs3

Most divergent pair5.8%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eubaphe meridianasame genus5.5%Eubaphe mendicasame genus5.5%Eubaphe lobulasame genus5.6%Eubaphe conformissame genus5.9%Scopula nigrinotatasame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 139 records

Wild obs. + sensor874

Museum / vouchered265

Range

Area of Occupancy AOO2 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 488≤1 km 100≤10 km 33>10 km 68

689 georeferenced · 185 without coordinates

Open the mapobservation + sensor874

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 11≤1 km 47≤10 km 139>10 km 20

217 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence265

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	78
Colorado State Universitylocation not on record	46
US	36
Tapachula, MX	26
King Saud Universitylocation not on record	18
East Lansing, US	12
Philadelphia, US	11
Milwaukee Public Museum (MPM)location not on record	9
Mississippi State, US	7
New Haven, US	6
San Diego, US	4
Awka, NG	4
Natural History Museum Rotterdamlocation not on record	2
Ciudad de México, MX	2
Cornell University Insect Collectionlocation not on record	1
St. Paul, US	1
Denver, US	1
Albuquerque, US	1

18 institutions · 265 of 265 vouchered records shown

09Environmental DNA26 detections

Where the DNA of Eubaphe unicolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C 17.1–23.6

Seasonal swing summer↔winter21.9 °C

Max temp (day)28.1 °C 23.1–30.6

Min temp (night)15.0 °C 10.9–18.0

Precipitation55.1 mm/mo 15.9–124

Air humidity53.2 % 39.1–56.0

Moisture balance-111 mm/mo -157–-29.7

Vapour deficit1,321 Pa 924–1,374

Wind speed4.20 m/s 2.30–4.90

Cloud cover28.0 % 18.4–34.4

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eubaphe unicolor

At a glance

Sources8 archives

At a glance

Record type1 139 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 139 records