Eubaphe mendica

(Walker, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Eubaphe

At a glance

Occurrence records4 624

Data sources8

Biological traits0

DNA specimens73

eDNA detections2

Sources8 archives

Databases and archives Eubaphe mendica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 624 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics73 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 624 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD73 specimens

01Narrative

Eubaphe mendica, the beggar, is a moth of the family Geometridae. It was first described by Francis Walker in 1854 and it is found in eastern North America. The wingspan is 21–30 mm. Adults are on wing from May to September. There are three generations per year. The larvae feed on Acer and Viola species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding73 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eubaphe mendica has left across the world's sequence archives.

At a glance

DNA specimens73

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus66 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

100Avariable

200Gmostly conserved

212Cvariable

220Cvariable

226Tmostly conserved

268Amostly conserved

313Tvariable

319Cmostly conserved

322Tmostly conserved

376Tmostly conserved

470Cvariable

502Amostly conserved

523Cvariable

547Cvariable

592Tmostly conserved

616Cmostly conserved

622Amostly conserved

AACCTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes20

BIN1

Most divergent pair2.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eubaphe lobulasame genus5.0%Eubaphe conformissame genus5.5%Eubaphe unicolorsame genus5.5%Euphyia unangulatasame family7.3%Euphyia intermediatasame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 624 records

Wild obs. + sensor3 963

Museum / vouchered661

Range

Area of Occupancy AOO10 600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 2 058≤1 km 618≤10 km 222>10 km 403

3 301 georeferenced · 662 without coordinates

Open the mapobservation + sensor3 963

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 13≤1 km 45≤10 km 231>10 km 66

355 georeferenced · 306 without coordinates

Open the institutions mapphysical evidence661

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	105
New Haven, US	87
St. Paul, US	76
Philadelphia, US	60
University of Alberta Museums (UAM)location not on record	49
Cleveland Museum of Natural History, OH (CLEV)location not on record	38
Georgia Museum of Natural Historylocation not on record	30
Mississippi State, US	25
CUlocation not on record	21
Washington, US	20
Royal Saskatchewan Museumlocation not on record	16
University of Guelph, Centre for Biodiversity Genomicslocation not on record	15
King Saud Universitylocation not on record	14
UDlocation not on record	10
Colorado State Universitylocation not on record	10
Cambridge, US	9
OSUClocation not on record	8
Cornell University Insect Collectionlocation not on record	7
Toronto, CA	5
Decorah, US	4
University of Guelphlocation not on record	4
Tartu, EE	3
Denver, US	3
Espace pour la vielocation not on record	3
ASUlocation not on record	3
SOVTlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
Champaign, US	2
Vernal, US	1
Blacksburg, US	1
San Francisco, US	1
Natural History Museum of Utahlocation not on record	1
Universidad Católica de Manizaleslocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Saint John, CA	1

35 institutions · 638 of 661 vouchered records shown · 23 without an institution code

09Environmental DNA2 detections

Where the DNA of Eubaphe mendica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 17.9–17.9

Seasonal swing summer↔winter24.2 °C

Max temp (day)23.1 °C

Min temp (night)12.6 °C

Precipitation124 mm/mo

Air humidity56.5 %

Moisture balance-13.8 mm/mo

Vapour deficit891 Pa

Wind speed3.00 m/s

Cloud cover42.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eubaphe mendica

At a glance

Sources8 archives

At a glance

Record type4 624 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 624 records