Euaresta bella

(Loew, 1862) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Euaresta

At a glance

Occurrence records623

Data sources6

Biological traits0

DNA specimens29

eDNA detections28

Sources6 archives

Databases and archives Euaresta bella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility623 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF623 records

Environmental DNA1 datasets · 2 countries28 detections

DNA & barcodingBOLD29 specimens

01Narrative

Euaresta bella is a species of tephritid or fruit flies in the family Tephritidae. The larvae feed on Ambrosia artemisiifolia, the only known host. There is one generation per year.Bugguide.net. Species Euaresta bella

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euaresta bella has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections28

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

1Amostly conserved

212Tmostly conserved

628Tmostly conserved

658Tmostly conserved

AACATTATATTTCATTTTTGGAGCTTGAGCAGGAATAATTGGAACATCATTAAGAATTATTATTCGAGCTGAATTAGGACACCCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes3

BIN1

Most divergent pair12.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euaresta aequalissame genus4.6%Euaresta stigmaticasame genus5.4%Euaresta bullanssame genus7.5%Euaresta reticulatasame genus8.4%Tephritis separatasame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type623 records

Wild obs. + sensor481

Museum / vouchered142

Range

Area of Occupancy AOO1 776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 245≤1 km 98≤10 km 20>10 km 44

407 georeferenced · 74 without coordinates

Open the mapobservation + sensor481

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤1 km 5≤10 km 19>10 km 2

26 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence142

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	43
Cleveland Museum of Natural History, OH (CLEV)location not on record	39
Essig Museum of Entomologylocation not on record	19
Provo, US	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	3
WIlocation not on record	3
Washington, US	3
Awka, NG	2
CUlocation not on record	1
Chicago, US	1
California State Collection of Arthropodslocation not on record	1

12 institutions · 134 of 142 vouchered records shown · 8 without an institution code

09Environmental DNA28 detections

Where the DNA of Euaresta bella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map2 countries0

14. Artificial - Terrestrial|14.5 Urban AreasGrasslandAgricultural

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 16.9–22.7

Seasonal swing summer↔winter26.4 °C

Max temp (day)25.2 °C 20.7–25.9

Min temp (night)16.1 °C 14.4–21.0

Precipitation98.3 mm/mo 79.6–98.6

Air humidity59.5 % 57.3–60.1

Moisture balance-59.8 mm/mo -63.4–-2.70

Vapour deficit1,037 Pa 771–1,100

Wind speed3.50 m/s 2.90–4.00

Cloud cover39.7 % 36.4–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)