Euaresta aequalis

(Loew, 1862) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Euaresta

At a glance

Occurrence records462

Data sources6

Biological traits0

DNA specimens10

eDNA detections8

Sources6 archives

Databases and archives Euaresta aequalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility462 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF462 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD10 specimens

01Narrative

Euaresta aequalis is a species of fruit fly in the genus Euaresta of the family Tephritidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euaresta aequalis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

1Amostly conserved

13Cmostly conserved

19Cmostly conserved

70Tmostly conserved

82Tmostly conserved

91Tmostly conserved

92Amostly conserved

100Avariable

106Cmostly conserved

196Amostly conserved

197Cmostly conserved

205Tvariable

212Cvariable

232Tmostly conserved

284Cmostly conserved

292Cmostly conserved

295Tmostly conserved

298Amostly conserved

300Amostly conserved

316Amostly conserved

322Amostly conserved

334Cmostly conserved

364Tvariable

370Avariable

371Gmostly conserved

397Tmostly conserved

406Cmostly conserved

442Tmostly conserved

451Tmostly conserved

487Cmostly conserved

490Tmostly conserved

499Cmostly conserved

500Cmostly conserved

505Cmostly conserved

518Gmostly conserved

532Amostly conserved

535Amostly conserved

536Cmostly conserved

547Amostly conserved

610Cvariable

619Tmostly conserved

631Tmostly conserved

646Tmostly conserved

AACATTATATTTCATTTTCGGAGCTTGAGCAGGAATAATTGGAACATCATTAAGAATTATTATTCGAGCTGAATTAGGACATCCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes4

BIN1

Most divergent pair5.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euaresta bellasame genus4.6%Euaresta stigmaticasame genus6.7%Euaresta bullanssame genus7.2%Euaresta reticulatasame genus7.8%Tephritis formosasame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type462 records

Wild obs. + sensor325

Museum / vouchered137

Range

Area of Occupancy AOO1 052 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 121≤1 km 40≤10 km 69>10 km 33

263 georeferenced · 62 without coordinates

Open the mapobservation + sensor325

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤1 km 34≤10 km 43>10 km 10

87 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	51
Essig Museum of Entomologylocation not on record	27
San Francisco, US	15
Provo, US	13
DAFlocation not on record	10
Australian National Fish Collectionlocation not on record	4
ASUlocation not on record	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Natick, US	2
Albuquerque, US	1
CUlocation not on record	1

11 institutions · 131 of 137 vouchered records shown · 6 without an institution code

09Environmental DNA8 detections

Where the DNA of Euaresta aequalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 17.7–22.2

Seasonal swing summer↔winter26.4 °C

Max temp (day)24.9 °C 21.6–30.9

Min temp (night)14.4 °C 14.0–18.3

Precipitation87.9 mm/mo 18.8–92.5

Air humidity60.0 % 52.9–60.1

Moisture balance-57.2 mm/mo -143–-15.0

Vapour deficit1,039 Pa 814–1,260

Wind speed3.20 m/s 2.90–3.50

Cloud cover37.7 % 23.5–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)