Echiophis intertinctus

(Richardson, 1848) · species

image placeholder — illustration coming later

Animalia/Chordata/Anguilliformes/Ophichthidae/Echiophis

At a glance

Occurrence records341

Data sources9

Biological traits5

DNA specimens9

eDNA detections9

Sources9 archives

Databases and archives Echiophis intertinctus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility165 records↗

OBISOcean Biodiversity Information System176 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS341 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

The spotted spoon-nose eelCommon names of Echiophis intertinctus at www.fishbase.org. (Echiophis intertinctus) is an eel in the family Ophichthidae (worm/snake eels).Echiophis intertinctus at www.fishbase.org. It was described by John Richardson in 1848. It is a marine, tropical eel which is known from the western Atlantic Ocean, including North Carolina, USA, the northern Gulf of Mexico, and Brazil. It is known to dwell at a depth of 100 m, and inhabits soft benthic sediments. Males can reach a maximum total length of 180 cm, but more commonly reach a TL of 150 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length180 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits2

Depth max100 m

Vulnerability90

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Echiophis intertinctus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.07%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

214Amostly conserved

CCTGTACTTAGTATTTGGTGCTTGAGCTGGGATGGTGGGCACTGCTTTAAGCCTACTAATCCGAGCCGAACTAAGCCAACCAGGAGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Echiophis punctifersame genus8.1%Ophichthus gomesiisame family9.8%Ophichthus zophochirsame family12.0%Ophisurus serpenssame family12.1%Ophichthus urolophussame family12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type341 records

Wild obs. + sensor101

Museum / vouchered240

Origin

Native14

Range

Area of Occupancy AOO916 km²

Depth

0–200 m sunlit48

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 33 m · max 143.5 m · 48 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 21≤1 km 13≤10 km 5>10 km 9

48 georeferenced · 53 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 3≤1 km 10≤10 km 47>10 km 8

68 georeferenced · 172 without coordinates

Open the institutions mapphysical evidence240

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	35
Washington, US	14
FishBaselocation not on record	11
Texas Cooperative Wildlife Collectionlocation not on record	10
University of Texas Biodiversity Collections (UTBC)location not on record	9
University of Alabamalocation not on record	3
New Haven, US	2
INMAlocation not on record	2
North Carolina Museum of Natural Scienceslocation not on record	2
UNICAMPlocation not on record	2
Wuzhou, CN	1
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	1
Montgomery, US	1
Texas Memorial Museum, Texas Natural History Collectionlocation not on record	1
Cambridge, US	1
PUC-RSlocation not on record	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1
Los Angeles, US	1
Frankfurt am Main	1

19 institutions · 99 of 240 vouchered records shown · 4 without an institution code

09Environmental DNA9 detections

Where the DNA of Echiophis intertinctus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 19.5–27.7

Seasonal swing summer↔winter8.70 °C

Max temp (day)25.7 °C 21.0–28.6

Min temp (night)23.9 °C 18.3–26.7

Precipitation123 mm/mo 50.9–161

Air humidity60.5 % 57.8–64.0

Vapour deficit1,214 Pa 972–1,346

Cloud cover33.3 % 29.7–42.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)