Ophisurus serpens

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Chordata/Anguilliformes/Ophichthidae/Ophisurus

At a glance

Occurrence records1 678

Data sources8

Biological traits7

DNA specimens18

eDNA detections0

Sources8 archives

Databases and archives Ophisurus serpens's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 073 records↗

OBISOcean Biodiversity Information System605 records↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS1 678 records

DNA & barcodingBOLD18 specimens

01Narrative

The serpent eel or sand snake-eel (Ophisurus serpens) is an eel found in the eastern Atlantic Ocean, western Mediterranean Sea, western Indian Ocean, western Pacific Ocean and the north-east and west coast of North Island in New Zealand. It is an elongated, slender fish with a length of up to 250 centimetres. It spends the day with its body immersed in the sediment, emerging into the open water at night.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length250 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceminor commercial

Other traits2

Depth max300 m

Vulnerability90

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ophisurus serpens has left across the world's sequence archives.

At a glance

DNA specimens18

BINs3

Marker genes1

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 77% of positions are identical in every specimen.

Where individuals differ — all 153 variable positions, in barcode order

7Tmostly conserved

8Cmostly conserved

16Tmostly conserved

31Amostly conserved

37Avariable

40Tmostly conserved

43Tmostly conserved

46Cmostly conserved

49Amostly conserved

55Gmostly conserved

56Cmostly conserved

61Tmostly conserved

67Cmostly conserved

70Amostly conserved

71Cmostly conserved

73Amostly conserved

76Cmostly conserved

85Amostly conserved

91Tmostly conserved

94Gmostly conserved

97Amostly conserved

112Cmostly conserved

118Tmostly conserved

121Tmostly conserved

124Tmostly conserved

127Gmostly conserved

130Amostly conserved

133Tmostly conserved

139Tmostly conserved

163Gmostly conserved

169Amostly conserved

175Tmostly conserved

178Amostly conserved

181Amostly conserved

184Cmostly conserved

187Cmostly conserved

196Amostly conserved

199Gmostly conserved

202Amostly conserved

203Cmostly conserved

220Amostly conserved

223Tmostly conserved

226Amostly conserved

247Cmostly conserved

256Cmostly conserved

262Cmostly conserved

263Cmostly conserved

265Tmostly conserved

268Cmostly conserved

271Cmostly conserved

274Amostly conserved

278Tmostly conserved

280Amostly conserved

283Tmostly conserved

284Tmostly conserved

286Gmostly conserved

287Cmostly conserved

289Amostly conserved

290Gmostly conserved

295Tmostly conserved

298Cmostly conserved

299Gmostly conserved

300Gmostly conserved

301Amostly conserved

304Cmostly conserved

310Cmostly conserved

313Amostly conserved

316Amostly conserved

322Amostly conserved

331Tmostly conserved

334Amostly conserved

337Cmostly conserved

340Gvariable

343Cmostly conserved

346Amostly conserved

349Tmostly conserved

352Cmostly conserved

355Tmostly conserved

356Cmostly conserved

358Tmostly conserved

361Tmostly conserved

364Cmostly conserved

367Cmostly conserved

373Tmostly conserved

376Tmostly conserved

379Tmostly conserved

382Cmostly conserved

394Tmostly conserved

397Tmostly conserved

400Cmostly conserved

403Tmostly conserved

406Cmostly conserved

409Cmostly conserved

413Gmostly conserved

415Cmostly conserved

421Amostly conserved

424Cmostly conserved

425Cmostly conserved

427Amostly conserved

430Amostly conserved

433Amostly conserved

439Cmostly conserved

445Tvariable

454Tmostly conserved

455Avariable

460Tmostly conserved

472Gmostly conserved

475Amostly conserved

480Cmostly conserved

481Amostly conserved

490Amostly conserved

493Tmostly conserved

497Cmostly conserved

502Cmostly conserved

505Cmostly conserved

511Cmostly conserved

514Tmostly conserved

515Cmostly conserved

520Amostly conserved

523Gmostly conserved

+33 more variable positions not shown

CCTATATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGTACTGCCCTAAGCCTGCTAATTCGAGCCGAACTAAGCCAACCCGGAGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.5%

Haplotypes7

BINs3

Most divergent pair18.7%

OceaniaAsiaAfricaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ophichthus urolophussame family8.6%Ophichthus puncticepssame family9.8%Ophichthus rufussame family10.0%Ophichthus remigersame family10.3%Echiophis punctifersame family10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 678 records

Wild obs. + sensor903

Museum / vouchered715

Other60

Origin

Native14

Range

Area of Occupancy AOO2 532 km²

Depth

0–200 m sunlit98

200–1000 m twilight58

1–4 km midnight0

>4 km abyssal0

median 139.9 m · max 850 m · 156 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 314≤1 km 342≤10 km 43>10 km 12

711 georeferenced · 192 without coordinates

Open the mapobservation + sensor903

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 20≤1 km 56≤10 km 158>10 km 109

343 georeferenced · 372 without coordinates

Open the institutions mapphysical evidence715

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	72
South African Institute for Aquatic Biodiversitylocation not on record	57
Museums Victorialocation not on record	33
Western Australian Museumlocation not on record	16
QVMAGlocation not on record	13
Paris, FR	10
Natick, US	8
FishBaselocation not on record	7
ICM-CSIClocation not on record	6
Australian National Fish Collectionlocation not on record	6
IEO-COMA-CSIClocation not on record	6
Auckland, NZ	4
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	4
Frankfurt am Main	3
Barcelona, ES	3
CASlocation not on record	3
Stockholm, SE	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
National Natural History Collectionslocation not on record	2
Cambridge, US	1
Museum of New Zealand Te Papa Tongarewalocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
University of California San Diegolocation not on record	1
MZLUlocation not on record	1
	1
Toronto, CA	1
ICATMARlocation not on record	1
South Kensington, GB	1
Zoologisches Museum Hamburglocation not on record	1
Chicago, US	1

30 institutions · 269 of 715 vouchered records shown · 31 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ophisurus serpens

At a glance

Sources8 archives

Size & morphology1

Habitat & environment3

Uses & economy1

Other traits2

At a glance

Record type1 678 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 30 geolocated

Record type1 678 records