Echinostrephus molaris

(Blainville, 1825) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Camarodonta/Echinometridae/Echinostrephus

At a glance

Occurrence records799

Data sources8

Biological traits4

DNA specimens12

eDNA detections5

Sources8 archives

Databases and archives Echinostrephus molaris's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility565 records↗

OBISOcean Biodiversity Information System234 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS799 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD12 specimens

01Narrative

Echinostrephus molaris is a species of echinoderms belonging to the family Echinometridae. The species is found in Indian and Pacific Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max50 m

Depth min0 m

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Echinostrephus molaris has left across the world's sequence archives.

At a glance

DNA specimens12

BINs3

Marker genes1

eDNA detections5

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 86 variable positions, in barcode order

5Tmostly conserved

11Amostly conserved

38Gvariable

53Cmostly conserved

56Cmostly conserved

77Avariable

83Cvariable

86Tmostly conserved

89Tmostly conserved

95Cvariable

98Tmostly conserved

110Cvariable

140Amostly conserved

143Tmostly conserved

149Amostly conserved

152Cmostly conserved

158Avariable

164Cmostly conserved

182Cmostly conserved

188Cmostly conserved

194Cmostly conserved

197Amostly conserved

200Tmostly conserved

212Tmostly conserved

218Cmostly conserved

221Tmostly conserved

243Tmostly conserved

251Cmostly conserved

254Cmostly conserved

257Cmostly conserved

260Cmostly conserved

266Tmostly conserved

272Cmostly conserved

275Cmostly conserved

287Gmostly conserved

305Cmostly conserved

308Amostly conserved

311Tmostly conserved

314Cmostly conserved

317Tmostly conserved

320Cmostly conserved

323Amostly conserved

326Amostly conserved

335Tmostly conserved

338Avariable

341Avariable

350Avariable

353Tmostly conserved

356Avariable

362Tmostly conserved

371Cmostly conserved

386Tmostly conserved

395Amostly conserved

398Tmostly conserved

410Cmostly conserved

428Cmostly conserved

437Gmostly conserved

443Gmostly conserved

452Avariable

461Tmostly conserved

468Cmostly conserved

476Avariable

482Cmostly conserved

488Cmostly conserved

494Gmostly conserved

497Tmostly conserved

506Tmostly conserved

509Tmostly conserved

515Amostly conserved

518Avariable

521Cmostly conserved

524Gmostly conserved

533Gmostly conserved

539Gmostly conserved

548Cvariable

551Cvariable

554Tmostly conserved

563Gmostly conserved

579Cmostly conserved

584Amostly conserved

590Cmostly conserved

596Tmostly conserved

605Amostly conserved

611Gmostly conserved

623Tmostly conserved

650Gmostly conserved

TTGGTAACTGACTTATCCCACTAATGATAGGTGCACCGGACATGGCTTTCCCCCGCATGAAAAAAATGAGCTTCTGACTAGTCCCTCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes8

BINs3

Most divergent pair3.4%

AfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Echinostrephus aciculatussame genus13.1%Heliocidaris tuberculatasame family13.8%Heliocidaris crassispinasame family14.6%Heliocidaris erythrogrammasame family14.7%Tripneustes depressussame order15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type799 records

Wild obs. + sensor591

Museum / vouchered206

Other2

Range

Area of Occupancy AOO980 km²

Depth

0–200 m sunlit80

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3.9 m · max 24 m · 80 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 57≤1 km 47≤10 km 81>10 km 25

210 georeferenced · 381 without coordinates

Open the mapobservation + sensor591

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 6≤1 km 21≤10 km 16>10 km 7

50 georeferenced · 156 without coordinates

Open the institutions mapphysical evidence206

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	28
Western Australian Museumlocation not on record	14
Washington, US	11
Earth Sciences New Zealandlocation not on record	10
Cambridge, US	8
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
BIKlocation not on record	7
Sydney, AU	7
Brussels, BE	5
Museums Victorialocation not on record	4
RBINS-Scientific Heritagelocation not on record	3
Chicago, US	2
Los Angeles, US	1
University museum (Fujukan)location not on record	1

14 institutions · 108 of 206 vouchered records shown · 6 without an institution code

09Environmental DNA5 detections

Where the DNA of Echinostrephus molaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)