Echinostrephus aciculatus

A.Agassiz, 1863 · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Camarodonta/Echinometridae/Echinostrephus

At a glance

Occurrence records3 507

Data sources6

Biological traits4

DNA specimens12

eDNA detections12

Sources6 archives

Databases and archives Echinostrephus aciculatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility580 records↗

OBISOcean Biodiversity Information System2 927 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS3 507 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Echinostrephus aciculatus est une espèce d'oursins réguliers de la famille des Echinometridae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max50 m

Depth min0 m

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Echinostrephus aciculatus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P637 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

58Avariable

97Avariable

148Amostly conserved

211Cvariable

214Cvariable

253Cvariable

274Cvariable

283Avariable

310Amostly conserved

316Cvariable

319Tvariable

322Cvariable

328Avariable

367Cvariable

385Tvariable

391Tvariable

421Tvariable

475Tvariable

502Gvariable

517Cvariable

550Tvariable

553Tmostly conserved

562Cmostly conserved

613Tvariable

AGCCTGAGCCGGCATGGTAGGAACAGCCATGAGTGTTATTATCCGCGCCGAACTAGCACAACCTGGCTCTTTACTAAAAGACGACCAAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes3

BINs2

Most divergent pair3.1%

AsiaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Echinometra mathaeisame family13.8%Heliocidaris crassispinasame family13.8%Echinometra oblongasame family14.4%Evechinus chloroticussame family14.5%Tripneustes ventricosussame order14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 507 records

Wild obs. + sensor3 318

Museum / vouchered189

Range

Area of Occupancy AOO2 036 km²

Depth

0–200 m sunlit2 818

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 12 m · max 171 m · 2 818 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 432≤1 km 204≤10 km 41>10 km 19

696 georeferenced · 2 622 without coordinates

Open the mapobservation + sensor3 318

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 5≤1 km 26≤10 km 32>10 km 6

69 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence189

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	23
Washington, US	17
CASlocation not on record	13
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	10
Cambridge, US	9
Los Angeles, US	9
Universidad Católica del Nortelocation not on record	8
Natick, US	7
Earth Sciences New Zealandlocation not on record	3
University of Floridalocation not on record	3
Honolulu, US	2
Museums Victorialocation not on record	1
Auckland, NZ	1

13 institutions · 106 of 189 vouchered records shown · 1 without an institution code

09Environmental DNA12 detections

Where the DNA of Echinostrephus aciculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

outer reef slope

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 13.9–23.6

Seasonal swing summer↔winter3.30 °C

Max temp (day)25.0 °C 15.7–25.0

Min temp (night)22.4 °C 10.8–22.4

Precipitation50.7 mm/mo 50.7–227

Air humidity59.7 % 59.7–62.8

Vapour deficit1,166 Pa 723–1,166

Cloud cover33.5 % 33.5–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Echinostrephus aciculatus

At a glance

Sources6 archives

Habitat & environment2

Other traits2

At a glance

Record type3 507 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 507 records