Echinometra oblonga

(Blainville, 1825) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Camarodonta/Echinometridae/Echinometra

At a glance

Occurrence records794

Data sources10

Biological traits2

DNA specimens272

eDNA detections272

Sources10 archives

Databases and archives Echinometra oblonga's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility635 records↗

OBISOcean Biodiversity Information System159 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI272 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics272 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionNPASS11 compounds

Occurrence & distributionGBIF · OBIS794 records

Environmental DNA1 datasets · 4 countries272 detections

DNA & barcodingBOLD272 specimens

01Narrative

Echinometra oblonga, also called the oblong urchin or 'ina 'ele 'ele (ina= generic name for urchin, 'ele 'ele= blackish) in Hawaiian, is a very common rock boring urchin on shallow rocky shores of the tropical Indo-Pacific and Southern Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

03Chemical composition11 compounds

Compounds documented for Echinometra oblonga across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Acetogenins3

Kavalactones and derivatives3

Flavanones $ Kavalactones and derivatives1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Annonacin	present	NPASS
(2R)-4-[(2S,13R)-2,13-dihydroxy-13-[(2R,5R)-5-[(1R)-1-hydroxytridecyl]oxolan-2-yl]tridecyl]-2-methyl-2H-furan-5-one	present	NPASS
(2R)-4-[(8R,13R)-8,13-dihydroxy-13-[(2S,5R)-5-[(1S)-1-hydroxytridecyl]oxolan-2-yl]tridecyl]-2-methyl-2H-furan-5-one	present	NPASS
(2S)-2-[(1R,2S)-1,2-dihydroxy-2-phenylethyl]-2,3-dihydropyran-6-one	present	NPASS
(2S)-5-hydroxy-7-[(1S,2S)-2-hydroxy-2-[(2S)-6-oxo-2,3-dihydropyran-2-yl]-1-phenylethoxy]-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
(4S,6S)-6-[(1S,2S)-1,2-dihydroxy-2-phenylethyl]-4-hydroxyoxan-2-one	present	NPASS
ALXRVCOFRNFMER-JNRWAQIZSA-N	present	NPASS
Goniothalamin	present	NPASS
HHUIWONHQASLSE-QKUYTOGTSA-N	present	NPASS
Leiocarpin A	present	NPASS

05DNA & barcoding272 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Echinometra oblonga has left across the world's sequence archives.

At a glance

DNA specimens272

BINs1

Marker genes3

eDNA detections272

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus248 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

268Cmostly conserved

388Cmostly conserved

586Amostly conserved

TGCCATGAGCGTTATTATTCGAGCTGAACTAGCACAACCTGGCTCATTACTAAAAGACGACCAAATCTACAAAGTGGTCGTTACAGCACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 93 variants.

Diversity (π)0.40%

Haplotypes93

BIN1

Most divergent pair2.4%

AsiaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Echinometra mathaeisame genus3.8%Echinometra viridissame genus12.4%Echinometra lucuntersame genus12.4%Echinometra vanbruntisame genus13.5%Toxopneustes pileolussame order14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type794 records

Wild obs. + sensor354

Museum / vouchered439

Fossil1

Range

Area of Occupancy AOO892 km²

Depth

0–200 m sunlit16

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 0 m · max 441 m · 17 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 190≤1 km 42≤10 km 11>10 km 7

250 georeferenced · 104 without coordinates

Open the mapobservation + sensor354

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 17≤1 km 10≤10 km 24>10 km 16

67 georeferenced · 372 without coordinates

Open the institutions mapphysical evidence439

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	57
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	28
Cambridge, US	20
CASlocation not on record	18
Earth Sciences New Zealandlocation not on record	10
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	8
Los Angeles, US	4
Honolulu, US	3
University of Floridalocation not on record	1
University museum (Fujukan)location not on record	1

10 institutions · 150 of 439 vouchered records shown · 170 without an institution code

09Environmental DNA272 detections

Where the DNA of Echinometra oblonga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found272

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 272 detections have coordinates

Open the map4 countries0

barrier reef

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 23.7–26.5

Seasonal swing summer↔winter2.00 °C

Max temp (day)26.1 °C 25.7–27.2

Min temp (night)24.7 °C 21.2–25.7

Precipitation108 mm/mo 86.1–520

Air humidity64.4 % 63.9–70.9

Vapour deficit1,165 Pa 851–1,206

Cloud cover43.8 % 38.2–60.9

CHELSA 1981–2010, ~9 km grid, at location & month of 256 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)