Echinometra viridis

A.Agassiz, 1863 · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Camarodonta/Echinometridae/Echinometra

At a glance

Occurrence records2 640

Data sources8

Biological traits4

DNA specimens58

eDNA detections44

Sources8 archives

Databases and archives Echinometra viridis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 437 records↗

OBISOcean Biodiversity Information System1 203 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS2 640 records

Environmental DNA1 datasets · 3 countries44 detections

DNA & barcodingBOLD58 specimens

01Narrative

Echinometra viridis, the reef urchin, is a species of sea urchin in the family Echinometridae. It is found on reefs in very shallow parts of the western Atlantic Ocean and the Caribbean Sea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max40 m

Depth min0 m

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Echinometra viridis has left across the world's sequence archives.

At a glance

DNA specimens58

BINs1

Marker genes4

eDNA detections44

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

277Tmostly conserved

376Gmostly conserved

406Tmostly conserved

AACACTTTATTTGATCTTCGGAGCTTGAGCTGGCATGGTAGGAACAGCTATGAGTGTGATTATTCGTGCCGAACTAGCACAGCCCGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Echinometra lucuntersame genus3.3%Echinometra vanbruntisame genus9.1%Echinometra oblongasame genus12.4%Echinometra mathaeisame genus12.4%Heterocentrotus mamillatussame family14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16SCYTB

animal barcoderibosomalmitochondrial

08Occurrence & distribution

Record type2 640 records

Wild obs. + sensor1 841

Museum / vouchered760

Cultivated / captive36

Fossil3

Origin

Native8

Range

Area of Occupancy AOO2 212 km²

Depth

0–200 m sunlit983

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10.5 m · max 40 m · 983 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 422≤1 km 98≤10 km 51>10 km 32

603 georeferenced · 1 238 without coordinates

Open the mapobservation + sensor1 841

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 229≤1 km 15≤10 km 20>10 km 17

281 georeferenced · 479 without coordinates

Open the institutions mapphysical evidence760

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 36 records without

Open the mapnot free-living36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Facultad de Ciencias Biológicas y Agropecuarias, Universidad Veracruzana, Región Poza Rica-Tuxpanlocation not on record	159
Washington, US	96
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	80
Los Angeles, US	50
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	38
Cambridge, US	32
FCMMlocation not on record	26
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	11
No Voucher Tissuelocation not on record	10
UM-RSMASlocation not on record	9
Universidad de Antioquia (UdeA)location not on record	7
Texas Cooperative Wildlife Collectionlocation not on record	7
CASlocation not on record	6
INVEMAR \| UNALlocation not on record	5
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	4
Universidad El Bosque (El Bosque)location not on record	3
ECOMAR lab University of Reunionlocation not on record	3
Brussels, BE	2
Santa Barbara Museum of Natural Historylocation not on record	1
Stockholm, SE	1
RBINS-Scientific Heritagelocation not on record	1

21 institutions · 551 of 760 vouchered records shown · 15 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA44 detections

Where the DNA of Echinometra viridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found44

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 44 detections have coordinates

Open the map3 countries0

Plankton

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 24.1–26.4

Seasonal swing summer↔winter1.70 °C

Max temp (day)28.0 °C 26.9–28.1

Min temp (night)24.0 °C 20.7–24.7

Precipitation278 mm/mo 183–372

Air humidity65.3 % 62.6–68.6

Moisture balance128 mm/mo 23.4–217

Vapour deficit1,170 Pa 998–1,182

Wind speed2.80 m/s 2.00–4.50

Cloud cover37.5 % 22.5–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Echinometra viridis

At a glance

Sources8 archives

Habitat & environment2

Other traits2

At a glance

Record type2 640 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions5 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 640 records