Drasteria howlandii

Grote, 1865 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Drasteria

At a glance

Occurrence records763

Data sources7

Biological traits0

DNA specimens12

eDNA detections7

Sources7 archives

Databases and archives Drasteria howlandii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility763 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF763 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD12 specimens

01Narrative

Drasteria howlandii is a moth of the family Erebidae. It is found from British Columbia and Saskatchewan south through the western parts of the United States from Washington south to Arizona and Texas. The wingspan is about 35 mm. Adults are on wing from March to September. The larvae feed on Eriogonum species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drasteria howlandii has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

15Tmostly conserved

20Gmostly conserved

22Amostly conserved

88Amostly conserved

91Tvariable

163Avariable

169Tmostly conserved

235Tmostly conserved

287Tvariable

316Amostly conserved

463Tmostly conserved

533Tvariable

535Avariable

544Cvariable

568Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTACTTATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes5

BINs2

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Drasteria divergenssame genus3.0%Drasteria ineptasame genus3.2%Drasteria occultasame genus3.3%Drasteria herzisame genus3.3%Drasteria petricolasame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type763 records

Wild obs. + sensor294

Museum / vouchered469

Range

Area of Occupancy AOO1 636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 157≤1 km 25≤10 km 24>10 km 30

236 georeferenced · 58 without coordinates

Open the mapobservation + sensor294

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 143≤1 km 55≤10 km 99>10 km 23

320 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence469

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	275
University of Alberta Museums (UAM)location not on record	29
Oregon State Arthropod Collectionlocation not on record	26
University of Alabamalocation not on record	24
Vernal, US	23
US	21
Royal Saskatchewan Museumlocation not on record	12
St. Paul, US	11
King Saud Universitylocation not on record	10
Cambridge, US	10
Mississippi State, US	3
Natural History Museum of Utahlocation not on record	2
San Francisco, US	2
ASUlocation not on record	2
East Lansing, US	2
WWUlocation not on record	2
San Diego, US	1
Denver, US	1
Philadelphia, US	1
Santa Barbara Museum of Natural Historylocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

21 institutions · 459 of 469 vouchered records shown · 10 without an institution code

09Environmental DNA7 detections

Where the DNA of Drasteria howlandii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 9.40–27.1

Seasonal swing summer↔winter18.1 °C

Max temp (day)29.5 °C 16.6–33.4

Min temp (night)18.4 °C 3.80–21.0

Precipitation44.8 mm/mo 30.2–80.3

Air humidity50.1 % 46.8–52.2

Moisture balance-89.2 mm/mo -126–-54.0

Vapour deficit1,417 Pa 660–1,854

Wind speed3.50 m/s 2.60–4.60

Cloud cover24.2 % 19.5–25.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)