Drasteria divergens

Behr, 1870 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Drasteria

At a glance

Occurrence records864

Data sources7

Biological traits0

DNA specimens48

eDNA detections49

Sources7 archives

Databases and archives Drasteria divergens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility864 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF864 records

Environmental DNA1 datasets · 3 countries49 detections

DNA & barcodingBOLD48 specimens

01Narrative

Drasteria divergens is a moth of the family Erebidae. It is found from California to Colorado, north to British Columbia. The wingspan is about 44 mm. Adults are on wing from March to August in California.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drasteria divergens has left across the world's sequence archives.

At a glance

DNA specimens48

BINs2

Marker genes1

eDNA detections49

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

142Tvariable

202Tmostly conserved

235Tmostly conserved

265Avariable

271Tvariable

406Tmostly conserved

418Cvariable

442Tvariable

487Tvariable

517Avariable

520Avariable

532Cvariable

536Tmostly conserved

616Cvariable

634Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTACTTATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.96%

Haplotypes17

BINs2

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Drasteria graphicasame genus1.8%Drasteria occultasame genus2.1%Drasteria walshisame genus2.1%Drasteria sabulosasame genus2.1%Drasteria biformatasame genus2.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type864 records

Wild obs. + sensor284

Museum / vouchered580

Range

Area of Occupancy AOO1 556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 119≤1 km 52≤10 km 17>10 km 21

209 georeferenced · 75 without coordinates

Open the mapobservation + sensor284

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 13≤1 km 35≤10 km 77>10 km 34

159 georeferenced · 421 without coordinates

Open the institutions mapphysical evidence580

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	250
Oregon State Arthropod Collectionlocation not on record	57
Vernal, US	37
Colorado State Universitylocation not on record	36
New Haven, US	33
Cambridge, US	26
San Diego, US	26
University of Alberta Museums (UAM)location not on record	16
St. Paul, US	10
East Lansing, US	10
Natural History Museum of Utahlocation not on record	9
Santa Cruz, US	7
University of Alabamalocation not on record	5
US	5
Philadelphia, US	4
Auckland, NZ	3
WWUlocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
ASUlocation not on record	1
Champaign, US	1
King Saud Universitylocation not on record	1
OSUClocation not on record	1

22 institutions · 543 of 580 vouchered records shown · 37 without an institution code

09Environmental DNA49 detections

Where the DNA of Drasteria divergens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map3 countries0

Mixed Habitat3. Shrubland|3.4. Temperate ShrublandRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 12.9–24.7

Seasonal swing summer↔winter19.4 °C

Max temp (day)23.9 °C 18.4–32.8

Min temp (night)10.2 °C 6.20–18.2

Precipitation20.4 mm/mo 2.70–62.4

Air humidity47.1 % 44.7–53.9

Moisture balance-138 mm/mo -163–-72.1

Vapour deficit916 Pa 709–1,714

Wind speed1.80 m/s 1.50–3.10

Cloud cover25.9 % 12.4–38.5

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)