Drasteria graphica

Hübner, 1818 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Drasteria

At a glance

Occurrence records445

Data sources7

Biological traits0

DNA specimens10

eDNA detections6

Sources7 archives

Databases and archives Drasteria graphica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility445 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF445 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD10 specimens

01Narrative

Drasteria graphica, the graphic moth, is a moth of the family Erebidae. The species was first described by Jacob Hübner in 1818. It is found in the United States in coastal dunes from Maine to Florida, west to Mississippi. It is also found along the shores of the Great Lakes in Michigan and Wisconsin. Subspecies D. g. atlantica is listed as threatened in Connecticut."Connecticut's Endangered, Threatened and Special Concern Species 2015". State of Connecticut Department of Energy and Environmental Protection Bureau of Natural Resources. Retrieved January 19, 2018. The wingspan is 30–35 mm. Adults are on wing from May to August and fly during the day. Larvae consume Hudsonia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drasteria graphica has left across the world's sequence archives.

At a glance

DNA specimens10

BINs3

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

22Amostly conserved

76Avariable

82Tmostly conserved

235Cvariable

268Tmostly conserved

271Tmostly conserved

337Tmostly conserved

340Cvariable

364Tvariable

373Amostly conserved

385Tmostly conserved

451Cvariable

526Tvariable

532Cmostly conserved

553Tmostly conserved

562Amostly conserved

577Avariable

589Cvariable

610Cvariable

616Cvariable

625Amostly conserved

628Avariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCACTAAGTTTACTTATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes8

BINs3

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Drasteria divergenssame genus1.8%Drasteria mirificasame genus2.0%Drasteria eubaptasame genus2.6%Drasteria sabulosasame genus2.7%Drasteria ingeniculatasame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type445 records

Wild obs. + sensor166

Museum / vouchered279

Range

Area of Occupancy AOO772 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 56≤1 km 38≤10 km 24>10 km 16

134 georeferenced · 32 without coordinates

Open the mapobservation + sensor166

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 1≤1 km 36≤10 km 162>10 km 24

223 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence279

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	90
Cambridge, US	89
Washington, US	19
Philadelphia, US	18
East Lansing, US	18
Mississippi State, US	10
St. Paul, US	8
Colorado State Universitylocation not on record	7
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
UDlocation not on record	5
Georgia Museum of Natural Historylocation not on record	1
Toronto, CA	1

12 institutions · 271 of 279 vouchered records shown · 8 without an institution code

09Environmental DNA6 detections

Where the DNA of Drasteria graphica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 17.4–24.8

Seasonal swing summer↔winter14.1 °C

Max temp (day)25.1 °C 23.6–29.9

Min temp (night)14.6 °C 12.7–20.9

Precipitation117 mm/mo 101–125

Air humidity57.8 % 57.5–60.3

Moisture balance1.40 mm/mo -25.5–5.70

Vapour deficit952 Pa 840–1,237

Wind speed2.40 m/s 1.80–3.60

Cloud cover36.3 % 30.3–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)