Drasteria grandirena

Haworth, 1809 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Drasteria

At a glance

Occurrence records602

Data sources7

Biological traits2

DNA specimens14

eDNA detections14

Sources7 archives

Databases and archives Drasteria grandirena's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility602 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF602 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

Drasteria grandirena, the figure-seven moth or great kidney, is a moth of the family Erebidae first described by Adrian Hardy Haworth in 1809. It is found in North America from Ontario, Quebec and Nova Scotia, south to at least Georgia west to at least Arkansas The wingspan is about 35 mm. Adults are on wing from March to August in California. The larvae feed on Hamamelis virginiana.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drasteria grandirena has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections14

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

20Gmostly conserved

22Amostly conserved

28Amostly conserved

34Avariable

70Cmostly conserved

109Amostly conserved

112Tmostly conserved

214Amostly conserved

259Cmostly conserved

265Avariable

284Cmostly conserved

295Tmostly conserved

340Cvariable

343Cmostly conserved

355Cmostly conserved

439Tmostly conserved

581Tvariable

625Avariable

637Gvariable

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCATTAAGCTTACTTATTCGAGCCGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.90%

Haplotypes6

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Drasteria divergenssame genus3.6%Drasteria sabulosasame genus4.0%Drasteria eubaptasame genus4.1%Drasteria herzisame genus4.3%Drasteria biformatasame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type602 records

Wild obs. + sensor392

Museum / vouchered210

Range

Area of Occupancy AOO1 236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 196≤1 km 65≤10 km 38>10 km 17

316 georeferenced · 76 without coordinates

Open the mapobservation + sensor392

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 3≤1 km 49≤10 km 88>10 km 12

152 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence210

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	56
East Lansing, US	56
Mississippi State, US	30
Cambridge, US	27
North Carolina State University Insect Museumlocation not on record	9
University of Alberta Museums (UAM)location not on record	4
St. Paul, US	4
ASUlocation not on record	3
Georgia Museum of Natural Historylocation not on record	2
Philadelphia, US	1
King Saud Universitylocation not on record	1
Cornell University Insect Collectionlocation not on record	1
UDlocation not on record	1

13 institutions · 195 of 210 vouchered records shown · 15 without an institution code

09Environmental DNA14 detections

Where the DNA of Drasteria grandirena was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 17.3–25.9

Seasonal swing summer↔winter19.2 °C

Max temp (day)28.1 °C 23.2–31.2

Min temp (night)18.0 °C 12.0–21.3

Precipitation89.8 mm/mo 78.7–125

Air humidity58.3 % 55.7–60.7

Moisture balance-41.5 mm/mo -75.6–-26.7

Vapour deficit1,089 Pa 870–1,343

Wind speed2.30 m/s 1.90–5.60

Cloud cover38.9 % 30.3–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)