Drasteria fumosa

Strecker, 1898 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Drasteria

At a glance

Occurrence records598

Data sources7

Biological traits0

DNA specimens72

eDNA detections89

Sources7 archives

Databases and archives Drasteria fumosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility598 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI89 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF598 records

Environmental DNA1 datasets · 2 countries89 detections

DNA & barcodingBOLD72 specimens

01Narrative

Drasteria fumosa, the smoky arches, is a moth of the family Erebidae first described by Strecker in 1898. It is found from the US state of California east to Utah and Texas. The wingspan is 34–43 mm. Adults are on wing in summer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drasteria fumosa has left across the world's sequence archives.

At a glance

DNA specimens72

BINs1

Marker genes1

eDNA detections89

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus67 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

59Cmostly conserved

110Cmostly conserved

128Avariable

179Gmostly conserved

269Cmostly conserved

341Tmostly conserved

365Cmostly conserved

422Gmostly conserved

623Avariable

CATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTACTCATTCGAGCTGAATTGGGAAATCCAGGATCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes26

BIN1

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Drasteria divergenssame genus4.4%Drasteria sabulosasame genus4.4%Drasteria kusnezovisame genus4.6%Drasteria ineptasame genus4.6%Drasteria eubaptasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type598 records

Wild obs. + sensor133

Museum / vouchered465

Range

Area of Occupancy AOO516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 76≤1 km 13≤10 km 6>10 km 10

105 georeferenced · 28 without coordinates

Open the mapobservation + sensor133

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 6≤1 km 15≤10 km 46>10 km 11

78 georeferenced · 387 without coordinates

Open the institutions mapphysical evidence465

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	301
New Haven, US	37
San Diego, US	24
University of Alabamalocation not on record	21
Colorado State Universitylocation not on record	15
San Francisco, US	5
University of Alberta Museums (UAM)location not on record	4
Cornell University Insect Collectionlocation not on record	4
Cambridge, US	2
Denver, US	1
Mississippi State, US	1

11 institutions · 415 of 465 vouchered records shown · 50 without an institution code

09Environmental DNA89 detections

Where the DNA of Drasteria fumosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found89

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 89 detections have coordinates

Open the map2 countries0

Pinesyucca, rocky outcrop above hwy, UV

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 15.4–28.6

Seasonal swing summer↔winter15.8 °C

Max temp (day)32.2 °C 22.5–35.2

Min temp (night)17.2 °C 7.80–20.6

Precipitation12.7 mm/mo 2.70–16.4

Air humidity44.9 % 35.2–52.5

Moisture balance-155 mm/mo -201–-134

Vapour deficit1,714 Pa 924–2,621

Wind speed1.80 m/s 1.50–3.40

Cloud cover14.9 % 12.4–31.7

CHELSA 1981–2010, ~9 km grid, at location & month of 85 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)