Drasteria edwardsii

Behr, 1870 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Drasteria

At a glance

Occurrence records632

Data sources7

Biological traits0

DNA specimens53

eDNA detections52

Sources7 archives

Databases and archives Drasteria edwardsii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility632 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF632 records

Environmental DNA1 datasets · 2 countries52 detections

DNA & barcodingBOLD53 specimens

01Narrative

Drasteria edwardsii is a moth of the family Erebidae. It is found from Washington, through Oregon to California. The wingspan is 34–37 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drasteria edwardsii has left across the world's sequence archives.

At a glance

DNA specimens53

BINs2

Marker genes1

eDNA detections52

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

76Amostly conserved

79Gvariable

142Cvariable

235Tvariable

265Gvariable

271Cmostly conserved

283Cvariable

328Avariable

337Tmostly conserved

340Tmostly conserved

346Cvariable

367Cvariable

562Cvariable

568Tvariable

619Cvariable

620Gmostly conserved

621Cmostly conserved

622Tmostly conserved

625Gvariable

627Gmostly conserved

628Amostly conserved

630Gmostly conserved

631Amostly conserved

AACATTATATTTTATTTTTGGAATCTGAGCTGGAATAGTTGGAACTTCATTAAGTTTACTCATTCGAGCTGAATTAGGGAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes16

BINs2

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Drasteria divergenssame genus4.9%Drasteria mirificasame genus5.2%Drasteria pallescenssame genus5.2%Drasteria tejonicasame genus5.2%Drasteria sabulosasame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type632 records

Wild obs. + sensor252

Museum / vouchered380

Origin

Native1

Range

Area of Occupancy AOO1 048 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 108≤1 km 38≤10 km 22>10 km 9

177 georeferenced · 75 without coordinates

Open the mapobservation + sensor252

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 13≤1 km 52≤10 km 56>10 km 21

142 georeferenced · 238 without coordinates

Open the institutions mapphysical evidence380

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	137
San Diego, US	69
University of Alberta Museums (UAM)location not on record	22
Colorado State Universitylocation not on record	21
Santa Cruz, US	19
Cambridge, US	15
Oregon State Arthropod Collectionlocation not on record	11
New Haven, US	10
Vernal, US	9
University of California, Davislocation not on record	7
University of Alabamalocation not on record	6
East Lansing, US	5
San Francisco, US	3
St. Paul, US	3
Natural History Museum of Utahlocation not on record	2
Essig Museum of Entomologylocation not on record	2
Los Angeles, US	1
Centre for Biodiversity Genomicslocation not on record	1

18 institutions · 343 of 380 vouchered records shown · 37 without an institution code

09Environmental DNA52 detections

Where the DNA of Drasteria edwardsii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 17.0–24.7

Seasonal swing summer↔winter15.8 °C

Max temp (day)29.9 °C 23.2–32.8

Min temp (night)14.2 °C 11.3–18.2

Precipitation2.70 mm/mo 2.50–13.2

Air humidity45.3 % 44.9–56.6

Moisture balance-163 mm/mo -163–-154

Vapour deficit1,400 Pa 753–1,714

Wind speed1.80 m/s 1.50–2.20

Cloud cover14.9 % 11.8–18.4

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)