Drasteria adumbrata

Behr, 1870 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Drasteria

At a glance

Occurrence records820

Data sources6

Biological traits0

DNA specimens32

eDNA detections32

Sources6 archives

Databases and archives Drasteria adumbrata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility820 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF820 records

Environmental DNA1 datasets · 3 countries32 detections

DNA & barcodingBOLD32 specimens

01Narrative

Drasteria adumbrata, the shadowy arches, is a moth of the family Erebidae. The species was first described by Hans Hermann Behr in 1870. It is found from coast to coast in southern Canada, south in the west to California and Colorado, south in the east to New England and Michigan. Subspecies D. a. alleni is found from eastern Alberta to New York and Nova Scotia. Subspecies D. a. saxea occurs from southern British Columbia and south-west Alberta south to California and Colorado. The wingspan is about 32 mm. Adults are on wing in summer. The larvae feed on Vaccinium angustifolium and probably other Vaccinium species. It has also been recorded on Arctostaphylos uva-ursi.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drasteria adumbrata has left across the world's sequence archives.

At a glance

DNA specimens32

BINs2

Marker genes1

eDNA detections32

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

34Tmostly conserved

94Amostly conserved

190Amostly conserved

200Amostly conserved

226Tvariable

235Tvariable

268Tmostly conserved

271Tmostly conserved

328Amostly conserved

340Tmostly conserved

343Cmostly conserved

346Tmostly conserved

397Tvariable

547Tmostly conserved

574Cvariable

596Tmostly conserved

601Tmostly conserved

634Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCATTAAGTTTACTTATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.80%

Haplotypes7

BINs2

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Drasteria sabulosasame genus2.6%Drasteria eubaptasame genus2.7%Drasteria occultasame genus2.9%Drasteria divergenssame genus2.9%Drasteria biformatasame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type820 records

Wild obs. + sensor368

Museum / vouchered452

Range

Area of Occupancy AOO1 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 182≤1 km 58≤10 km 36>10 km 12

288 georeferenced · 80 without coordinates

Open the mapobservation + sensor368

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 62≤1 km 74≤10 km 94>10 km 22

252 georeferenced · 200 without coordinates

Open the institutions mapphysical evidence452

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	120
East Lansing, US	68
University of Alberta Museums (UAM)location not on record	46
New Haven, US	43
Oregon State Arthropod Collectionlocation not on record	43
Vernal, US	24
St. Paul, US	21
Royal Saskatchewan Museumlocation not on record	14
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
University of Alabamalocation not on record	7
Natural History Museum of Utahlocation not on record	6
Cambridge, US	6
Saint John, CA	5
Mississippi State, US	4
Toronto, CA	4
National Institute of Biological Resourceslocation not on record	3
ASUlocation not on record	3
WWUlocation not on record	2
SOVTlocation not on record	2
Cornell University Insect Collectionlocation not on record	2
Decorah, US	1
Denver, US	1
King Saud Universitylocation not on record	1
University of California, Davislocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

25 institutions · 438 of 452 vouchered records shown · 14 without an institution code

09Environmental DNA32 detections

Where the DNA of Drasteria adumbrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map3 countries0

1. Forest & Woodland | 1.4. Temperate ForestRiparian ZoneMixed HabitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 12.1–16.7

Seasonal swing summer↔winter23.5 °C

Max temp (day)21.9 °C 18.3–23.5

Min temp (night)10.8 °C 5.80–11.4

Precipitation73.2 mm/mo 36.0–111

Air humidity52.8 % 45.7–57.6

Moisture balance-72.8 mm/mo -126–-14.3

Vapour deficit882 Pa 675–941

Wind speed2.60 m/s 1.90–3.00

Cloud cover37.8 % 26.1–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)