Drapetisca alteranda

Chamberlin, 1909 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Drapetisca

At a glance

Occurrence records421

Data sources8

Biological traits1

DNA specimens57

eDNA detections57

Sources8 archives

Databases and archives Drapetisca alteranda's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility421 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

World Spider Trait DBMasaryk University1 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF421 records

Environmental DNA1 datasets · 2 countries57 detections

DNA & barcodingBOLD57 specimens

01Narrative

Drapetisca alteranda is a spider in the family Linyphiidae. It is found in the United States. This species can be found in leaves on the ground, however it is most often found on the surface of various deciduous and coniferous trees.Draney, M., Hegnet, J., Johnson, A., Porter, B., Justmann, C., & Forsythe, P. (2014). Microhabitat distribution of Drapetisca alteranda, a tree trunk specialist sheet web weaver (Araneae: Linyphiidae). The Journal of Arachnology, 42(2), 195-198. Retrieved March 4, 2021, from http://www.jstor.org/stable/24365322

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014a

Defence1

Primary defenceCrypsis

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drapetisca alteranda has left across the world's sequence archives.

At a glance

DNA specimens57

BINs1

Marker genes1

eDNA detections57

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P640 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

22Amostly conserved

208Avariable

262Amostly conserved

391Gmostly conserved

451Tmostly conserved

TTCTTTATATTTTATTTTTGGAGCATGAGCTGCTATAGTGGGTACTGCTATAAGAGTATTGATTCGAATTGAGTTAGGTCAAACTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes9

BIN1

Most divergent pair1.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Drapetisca socialissame genus7.7%Incestophantes washingtonisame family10.4%Incestophantes laricetorumsame family11.1%Agnyphantes arboreussame family11.6%Bolyphantes alticepssame family11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type421 records

Wild obs. + sensor284

Museum / vouchered137

Range

Area of Occupancy AOO1 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 140≤1 km 45≤10 km 13>10 km 25

223 georeferenced · 61 without coordinates

Open the mapobservation + sensor284

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 7≤1 km 4≤10 km 13>10 km 4

28 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	33
University of Guelph, Centre for Biodiversity Genomicslocation not on record	31
Denver, US	9
Albuquerque, US	7
Edmonton, CA	6
Ohio State University Acarology Laboratorylocation not on record	6
University of Alberta Museums (UAM)location not on record	3
Saint John, CA	2
Chicago, US	1
Champaign, US	1

10 institutions · 99 of 137 vouchered records shown · 38 without an institution code

09Environmental DNA57 detections

Where the DNA of Drapetisca alteranda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map2 countries0

1. Forest & Woodland1. Forest & Woodland|1.1. Boreal Foreston white cedar1. Forest & Woodland | 1.1. Boreal ForestForest1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 9.10–18.3

Seasonal swing summer↔winter26.9 °C

Max temp (day)19.0 °C 13.5–22.9

Min temp (night)11.1 °C 4.90–16.1

Precipitation98.7 mm/mo 79.2–150

Air humidity61.0 % 56.5–63.3

Moisture balance-4.80 mm/mo -41.3–83.2

Vapour deficit631 Pa 474–837

Wind speed3.00 m/s 1.80–3.90

Cloud cover46.6 % 38.1–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)