Agnyphantes arboreus

(Emerton, 1915) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agnyphantes

At a glance

Occurrence records265

Data sources7

Biological traits0

DNA specimens94

eDNA detections89

Sources7 archives

Databases and archives Agnyphantes arboreus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility265 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI89 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics94 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF265 records

Environmental DNA1 datasets · 2 countries89 detections

DNA & barcodingBOLD94 specimens

01Narrative

Agnyphantes arboreus est une espèce d'araignées aranéomorphes de la famille des Linyphiidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding94 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agnyphantes arboreus has left across the world's sequence archives.

At a glance

DNA specimens94

BINs3

Marker genes1

eDNA detections89

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P649 bp consensus89 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

22Tmostly conserved

25Amostly conserved

31Cmostly conserved

94Amostly conserved

106Cmostly conserved

124Tmostly conserved

130Tmostly conserved

160Amostly conserved

169Gmostly conserved

196Gmostly conserved

202Cmostly conserved

205Tmostly conserved

238Tmostly conserved

241Gmostly conserved

271Cmostly conserved

283Amostly conserved

316Amostly conserved

318Cmostly conserved

343Tmostly conserved

346Amostly conserved

376Tmostly conserved

385Cmostly conserved

397Tmostly conserved

406Tmostly conserved

415Cmostly conserved

433Gmostly conserved

451Tmostly conserved

472Amostly conserved

541Gmostly conserved

542Cvariable

601Tmostly conserved

610Cmostly conserved

616Tmostly conserved

640Tmostly conserved

646Cmostly conserved

TTCTTTATATTTTATTTTTGGTGCATGGGCCGCTATAGTGGGTACTGCTATAAGAGTATTAATTCGAATTGAATTAGGTCAAACTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes8

BINs3

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agnyphantes expunctussame genus6.5%Incestophantes crucifersame family10.2%Obscuriphantes obscurussame family10.5%Incestophantes washingtonisame family10.5%Poeciloneta bihamatasame family10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type265 records

Wild obs. + sensor2

Museum / vouchered263

Range

Area of Occupancy AOO324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 20≤1 km 6

26 georeferenced · 237 without coordinates

Open the institutions mapphysical evidence263

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	92
University of Guelph, Centre for Biodiversity Genomicslocation not on record	43
Edmonton, CA	25
Albuquerque, US	12
Cambridge, US	1
Royal British Columbia Museumlocation not on record	1
University of Alaska Museumlocation not on record	1

7 institutions · 175 of 263 vouchered records shown · 88 without an institution code

09Environmental DNA89 detections

Where the DNA of Agnyphantes arboreus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found89

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 89 detections have coordinates

Open the map2 countries0

1. Forest|1.2 Subarctic Forest1. Forest & Woodland|1.1. Boreal Forestsubalpine heath, CassiopeForest1. Forest & Woodland|1.2 Subarctic ForestMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.80 °C 7.20–11.5

Seasonal swing summer↔winter25.3 °C

Max temp (day)13.2 °C 12.7–15.4

Min temp (night)3.00 °C 1.50–6.40

Precipitation114 mm/mo 62.4–127

Air humidity58.2 % 56.8–62.5

Moisture balance-4.00 mm/mo -31.5–24.5

Vapour deficit445 Pa 440–548

Wind speed6.10 m/s 2.00–8.90

Cloud cover35.3 % 34.1–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 89 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)