Agnyphantes expunctus

(O.Pickard-Cambridge, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Agnyphantes

At a glance

Occurrence records1 040

Data sources7

Biological traits6

DNA specimens19

eDNA detections343

Sources7 archives

Databases and archives Agnyphantes expunctus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 040 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI343 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

World Spider Trait DBMasaryk University6 traits · 17 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements17 literature sources6 traits

Occurrence & distributionGBIF1 040 records

Environmental DNA3 datasets · 5 countries343 detections

DNA & barcodingBOLD19 specimens

01Narrative

Agnyphantes expunctus is een spinnensoort in de taxonomische indeling van de hangmatspinnen (Linyphiidae). Het dier behoort tot het geslacht Agnyphantes. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1875 door Octavius Pickard-Cambridge.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 17 sources

Buchar & Růžička 2002Hyvärinen et al. 2019Harvey et al. 2017Henriksen & Hilmo 2015Staręga et al. 2001Gajdoš et al. 2014SLU 2020Gajdoš & Svatoň 2001Řezáč et al. 2015Blick et al. 2016Nährig et al. 2003Blick & Scheidler 2004Finch 2004Buchholz et al. 2011Sacher & Platen 2004Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀2.15·♂2.15 mm

Predation1

Hunting guildsheet web weavers

Ecology4

Light 2partly shaded

Moisture 2humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryEndangered (EN)

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agnyphantes expunctus has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections343

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 77% of positions are identical in every specimen.

Where individuals differ — all 149 variable positions, in barcode order

1Tmostly conserved

3Tmostly conserved

4Amostly conserved

5Tmostly conserved

6Amostly conserved

8Tmostly conserved

11Amostly conserved

12Tmostly conserved

14Tmostly conserved

15Tmostly conserved

16Tmostly conserved

17Gmostly conserved

18Gmostly conserved

19Tvariable

20Gmostly conserved

21Cmostly conserved

22Amostly conserved

23Tmostly conserved

24Gmostly conserved

25Amostly conserved

26Gmostly conserved

27Cmostly conserved

28Tmostly conserved

29Gmostly conserved

30Cmostly conserved

31Tmostly conserved

32Amostly conserved

33Tmostly conserved

34Avariable

35Gmostly conserved

36Tmostly conserved

37Gvariable

38Gmostly conserved

39Gmostly conserved

40Tmostly conserved

41Amostly conserved

42Cmostly conserved

43Tmostly conserved

44Gmostly conserved

45Cmostly conserved

46Tmostly conserved

47Amostly conserved

48Tmostly conserved

49Amostly conserved

50Amostly conserved

51Gmostly conserved

52Amostly conserved

53Gmostly conserved

55Cvariable

56Tmostly conserved

57Tmostly conserved

58Amostly conserved

59Amostly conserved

60Tmostly conserved

61Tmostly conserved

62Cmostly conserved

63Gmostly conserved

64Amostly conserved

65Amostly conserved

66Tmostly conserved

67Tvariable

68Gmostly conserved

69Amostly conserved

70Gmostly conserved

71Tmostly conserved

72Tmostly conserved

73Gmostly conserved

74Gmostly conserved

75Gmostly conserved

76Cvariable

77Cmostly conserved

78Amostly conserved

79Amostly conserved

80Amostly conserved

81Cmostly conserved

82Tmostly conserved

83Gmostly conserved

87Gmostly conserved

88Amostly conserved

89Amostly conserved

92Tmostly conserved

93Tmostly conserved

94Gmostly conserved

103Cmostly conserved

109Amostly conserved

112Cmostly conserved

118Amostly conserved

127Tmostly conserved

130Amostly conserved

136Gmostly conserved

163Amostly conserved

178Amostly conserved

181Tmostly conserved

187Amostly conserved

193Gmostly conserved

196Amostly conserved

199Tmostly conserved

208Amostly conserved

211Amostly conserved

214Tmostly conserved

220Gmostly conserved

235Cmostly conserved

238Tmostly conserved

241Gmostly conserved

250Amostly conserved

253Amostly conserved

263Tmostly conserved

265Amostly conserved

268Tmostly conserved

278Amostly conserved

280Gmostly conserved

281Tmostly conserved

286Gmostly conserved

298Amostly conserved

304Tmostly conserved

307Amostly conserved

310Gmostly conserved

313Amostly conserved

320Amostly conserved

340Amostly conserved

+29 more variable positions not shown

TTTATATTTTATTTTTGGTGCATGAGCTGCTATAGTGGGTACTGCTATAAGAGTCTTAATTCGAATTGAGTTGGGCCAAACTGGAAGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.3%

Haplotypes3

BINs2

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agnyphantes arboreussame genus6.5%Obscuriphantes obscurussame family9.7%Bolephthyphantes indexsame family10.3%Incestophantes laricetorumsame family10.4%Poeciloneta variegatasame family10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 040 records

Wild obs. + sensor450

Museum / vouchered587

Other3

Origin

Native175

Range

Area of Occupancy AOO1 556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 134≤1 km 82≤10 km 218>10 km 3

437 georeferenced · 13 without coordinates

Open the mapobservation + sensor450

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 119≤1 km 74≤10 km 223>10 km 15

431 georeferenced · 156 without coordinates

Open the institutions mapphysical evidence587

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	210
Bern, CH	164
SLU Artdatabankenlocation not on record	67
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	26
Metsähallituslocation not on record	25
Ekaterinburg, RU	23
Paro, BT	6
NTNU-VMlocation not on record	6
Rovaniemi, FI	5
neflocation not on record	4
MZLUlocation not on record	4
BioFokuslocation not on record	3
Washington, US	3
NHMOlocation not on record	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
Uniwersytet w Białymstokulocation not on record	1
Cambridge, US	1
Tromso University Museumlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1

19 institutions · 554 of 587 vouchered records shown · 33 without an institution code

09Environmental DNA343 detections

Where the DNA of Agnyphantes expunctus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found343

Studies independent surveys3

Countries5

Verifiable raw sequence linked327

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 343 detections have coordinates

Open the map5 countries0

timberline forest, moss

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 6.00–14.0

Seasonal swing summer↔winter21.9 °C

Max temp (day)13.7 °C 7.90–16.9

Min temp (night)7.20 °C 2.50–10.2

Precipitation100 mm/mo 65.4–144

Air humidity63.0 % 57.5–67.3

Moisture balance38.0 mm/mo -10.1–61.0

Vapour deficit501 Pa 326–636

Wind speed2.50 m/s 2.00–4.10

Cloud cover52.5 % 47.2–61.2

CHELSA 1981–2010, ~9 km grid, at location & month of 343 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agnyphantes expunctus

At a glance

Sources7 archives

Morphometry1

Predation1

Ecology4

At a glance

Record type1 040 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 040 records