Doriopsilla albopunctata

(J.G.Cooper, 1863) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Dendrodorididae/Doriopsilla

At a glance

Occurrence records3 672

Data sources10

Biological traits4

DNA specimens34

eDNA detections27

Sources10 archives

Databases and archives Doriopsilla albopunctata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 450 records↗

OBISOcean Biodiversity Information System222 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Chemical compositionLOTUS · NPASS64 compounds

Occurrence & distributionGBIF · OBIS3 672 records

Environmental DNA1 datasets · 1 countries27 detections

DNA & barcodingBOLD34 specimens

01Narrative

Doriopsilla albopunctata, the white-spotted sea goddess, is a species of dorid nudibranch, a colorful sea slug, in the family Dendrodorididae.Rosenberg, G.; Bouchet, P. (2015). Doriopsilla albopunctata (J. G. Cooper, 1863). In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2016-12-13. It is native to the Pacific Coast of North America, from Mendocino County, California south, possibly to Baja California Peninsula, Mexico. There are five other species that are quite similar to Doriopsilla albopunctata and can be confused with it: Doriopsilla bertschi (Hoover, Lindsay, Goddard & Valdés, 2015), Doriopsilla davebehrensi (Hoover, Lindsay, Goddard & Valdés, 2015), Doriopsilla fulva (MacFarland, 1905), Doriopsilla gemela (Gosliner, Schaefer & Millen, 1999), and Baptodoris mimetica (Gosliner, 1991).Hoover C., Lindsay T., Goddard J.H.R. & Valdés A. (2015). Seeing double: pseudocryptic diversity in the Doriopsilla albopunctata–Doriopsilla gemela species complex of the north-eastern Pacific. Zoologica Scripta. 44: 612-631.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length4 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

03Chemical composition64 compounds

Compounds documented for Doriopsilla albopunctata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Bisabolane sesquiterpenoids11

Menthane monoterpenoids10

Ursane and Taraxastane triterpenoids4

Eudesmane sesquiterpenoids3

Phytane diterpenoids1

Documented compounds64 total

Tissue Source Quantified only

Compound	Amount	Source
(1R)-1-hydroxy-1-(2-hydroxy-4-methylphenyl)propan-2-one	present	NPASS
(1R,2R,4aR,5R,8aR)-4a-methyl-8-methylidene-2-propan-2-yl-1,2,3,4,5,6,7,8a-octahydronaphthalene-1,5-diol	present	NPASS
(1S,2R,3R,4R,5S)-2-methyl-5-propan-2-ylcyclohexane-1,2,3,4-tetrol	present	NPASS
(24R)-9,19-cycloart-25-ene-3beta,24-diol	present	NPASS
(2R)-2-(2-hydroxy-4-methylphenyl)propane-1,2-diol	present	NPASS
(2S,7S,11S)-7,11,15-trimethyl-3-methylidenehexadecane-1,2-diol	present	NPASS
(3S,4aS,6aS,6aR,6bR,8aR,12S,12aS,14aR,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicen-3-ol	present	NPASS
(5S,6S)-5-hydroxy-3-methyl-6-propan-2-ylcyclohex-3-en-1-one	present	NPASS
(E)-2-Isopropyl-5-methylphenyl 2-methylbut-2-enoate	present	NPASS
1-Isopropyl-4-methylbenzene	present	NPASS

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Doriopsilla albopunctata has left across the world's sequence archives.

At a glance

DNA specimens34

BINs2

Marker genes1

eDNA detections27

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

19Tmostly conserved

49Gvariable

94Cmostly conserved

109Tmostly conserved

154Cmostly conserved

157Cmostly conserved

178Cmostly conserved

205Gmostly conserved

292Avariable

304Gmostly conserved

313Tmostly conserved

337Cmostly conserved

367Tmostly conserved

385Tmostly conserved

445Tmostly conserved

460Tmostly conserved

568Gmostly conserved

574Gmostly conserved

580Amostly conserved

581Cmostly conserved

595Cmostly conserved

646Cmostly conserved

652Cmostly conserved

AACTTTATATGTTATTTTTGGAATATGGTGTGGTCTTTTAGGAACTGGGTTAAGATTATTGATTCGTTTTGAATTAGGGACTGCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes14

BINs2

Most divergent pair8.2%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Doriopsilla davebehrensisame genus7.6%Doriopsilla fulvasame genus8.4%Doriopsilla miniatasame genus17.6%Limacia jellyisame order17.7%Phyllidia exquisitasame order17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 672 records

Wild obs. + sensor3 433

Museum / vouchered239

Range

Area of Occupancy AOO2 420 km²

Depth

0–200 m sunlit146

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 20 m · max 28 m · 146 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 1 295≤1 km 947≤10 km 80>10 km 659

2 981 georeferenced · 452 without coordinates

Open the mapobservation + sensor3 433

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 26≤1 km 88≤10 km 57>10 km 12

183 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence239

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	81
Santa Barbara Museum of Natural Historylocation not on record	27
Los Angeles, US	9
Washington, US	6
Centre for Biodiversity Genomicslocation not on record	6
San Francisco, US	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Philadelphia, US	1
Museo de Historia Natural, Universidad Autónoma de Baja California Surlocation not on record	1
Paleontological Research Institutionlocation not on record	1

10 institutions · 139 of 239 vouchered records shown · 1 without an institution code

09Environmental DNA27 detections

Where the DNA of Doriopsilla albopunctata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map1 country0

rocky intertidalfloating docksIntertidal under and on rocks and cobblepier pilings, ca. 175 m from shore

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–15.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C 17.5–19.8

Min temp (night)8.20 °C 8.20–11.4

Precipitation79.6 mm/mo 29.7–79.6

Air humidity57.3 % 57.3–63.4

Moisture balance-38.4 mm/mo -87.0–-22.9

Vapour deficit733 Pa 614–733

Wind speed5.80 m/s 1.50–5.80

Cloud cover36.7 % 29.9–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Doriopsilla albopunctata

At a glance

Sources10 archives

Size & morphology1

Habitat & environment2

Other traits1

Compound class profile5 classes

Documented compounds64 total

At a glance

Record type3 672 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 672 records