Dineutus emarginatus

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Gyrinidae/Dineutus

At a glance

Occurrence records143

Data sources6

Biological traits0

DNA specimens14

eDNA detections10

Sources6 archives

Databases and archives Dineutus emarginatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility143 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF143 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD14 specimens

01Narrative

Dineutus emarginatus is a species of whirligig beetle in the family Gyrinidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dineutus emarginatus has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.23%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 5 variable positions, in barcode order

84Gmostly conserved

330Amostly conserved

372Amostly conserved

399Tmostly conserved

627Amostly conserved

ACATTATACTTTATTTTTGGTGCTTGATCAGGAATAGTAGGAACATCATTAAGAATATTAATTCGAGCAGAACTTGGAAATCCGGGTTCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dineutus assimilissame genus5.3%Dineutus nigriorsame genus6.2%Dineutus carolinussame genus7.6%Dineutus horniisame genus8.7%Dineutus discolorsame genus10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type143 records

Wild obs. + sensor4

Museum / vouchered139

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1>10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 25

25 georeferenced · 114 without coordinates

Open the institutions mapphysical evidence139

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	48
OSUClocation not on record	26
University Park, US	22
WIlocation not on record	21
Wuzhou, CN	11
University of Central Floridalocation not on record	6
New Haven, US	2
CUlocation not on record	1
Royal Saskatchewan Museumlocation not on record	1
Lexington, US	1

10 institutions · 139 of 139 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Dineutus emarginatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

Lake

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 18.1–28.6

Seasonal swing summer↔winter24.5 °C

Max temp (day)26.8 °C 22.6–34.1

Min temp (night)17.3 °C 14.5–24.4

Precipitation84.0 mm/mo 81.0–87.4

Air humidity58.5 % 57.4–59.3

Moisture balance-77.1 mm/mo -95.2–-59.4

Vapour deficit1,119 Pa 842–1,656

Wind speed3.10 m/s 2.00–3.20

Cloud cover36.4 % 27.2–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)