Dineutus assimilis

(Kirby, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Gyrinidae/Dineutus

At a glance

Occurrence records1 700

Data sources8

Biological traits0

DNA specimens14

eDNA detections10

Sources8 archives

Databases and archives Dineutus assimilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 700 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS1 compounds

Occurrence & distributionGBIF1 700 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD14 specimens

01Narrative

Dineutus assimilis is a species of whirligig beetle in the family Gyrinidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition1 compounds

Compounds documented for Dineutus assimilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Naphthalenes and derivatives1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Nepodin		present	NPASS

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dineutus assimilis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

4Amostly conserved

250Tmostly conserved

364Cvariable

478Gvariable

628Amostly conserved

637Amostly conserved

AACATTATATTTTATTTTTGGTGCTTGATCAGGAATAGTAGGAACATCATTAAGAATATTGATTCGAGCAGAACTTGGAAACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dineutus emarginatussame genus5.3%Dineutus nigriorsame genus5.9%Dineutus carolinussame genus5.9%Dineutus horniisame genus8.1%Dineutus indicussame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 700 records

Wild obs. + sensor19

Museum / vouchered1 681

Range

Area of Occupancy AOO1 336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 9≤10 km 1>10 km 1

11 georeferenced · 8 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 139≤1 km 114≤10 km 201>10 km 389

843 georeferenced · 838 without coordinates

Open the institutions mapphysical evidence1 681

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	826
Chicago, US	294
Lexington, US	189
WIlocation not on record	132
OSUClocation not on record	93
Sam Noble Oklahoma Museum of Natural Historylocation not on record	53
University Park, US	36
Royal Saskatchewan Museumlocation not on record	18
US	17
Champaign, US	16
Vancouver, CA	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Chicago, US	1
Biodiversity Institute of Ontariolocation not on record	1
Cornell University Insect Collectionlocation not on record	1

15 institutions · 1 680 of 1 681 vouchered records shown · 1 without an institution code

09Environmental DNA10 detections

Where the DNA of Dineutus assimilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

PondPond/StreamRiver

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 15.0–22.8

Seasonal swing summer↔winter28.4 °C

Max temp (day)22.5 °C 19.1–28.6

Min temp (night)15.3 °C 11.1–19.6

Precipitation83.3 mm/mo 68.8–147

Air humidity59.9 % 55.1–60.8

Moisture balance-49.6 mm/mo -116–27.8

Vapour deficit874 Pa 688–1,290

Wind speed3.50 m/s 2.80–5.00

Cloud cover41.0 % 31.4–48.0

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dineutus assimilis

At a glance

Sources8 archives

Compound class profile1 class

Documented compounds1 total

At a glance

Record type1 700 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 700 records