Dinaraea angustula

(Gyllenhal, 1810) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Dinaraea

At a glance

Occurrence records1 021

Data sources7

Biological traits0

DNA specimens8

eDNA detections34

Sources7 archives

Databases and archives Dinaraea angustula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 021 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 021 records

Environmental DNA4 datasets · 5 countries34 detections

DNA & barcodingBOLD8 specimens

01Narrative

Dinaraea angustula is a species of rove beetle in the family Staphylinidae. It is found in Europe and Northern Asia (excluding China) and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dinaraea angustula has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections34

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P634 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes1

BIN1

Where individuals differ — all 15 variable positions, in barcode order

43Avariable

79Avariable

214Avariable

232Cvariable

247Cvariable

286Avariable

343Tvariable

368Gvariable

373Avariable

376Tvariable

394Cvariable

466Avariable

469Cvariable

502Gvariable

578Cvariable

CACCTTATACTTCATTTTTGGAGCTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGTGCTGAACTTGGAAATCCCGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrolocha sulculasame family12.3%Atheta amiculasame family12.6%Gyrophaena laetulasame family12.8%Tachinus fimetariussame family12.9%Aleochara bimaculatasame family13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 021 records

Wild obs. + sensor507

Museum / vouchered509

Cultivated / captive5

Range

Area of Occupancy AOO2 372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 226≤1 km 132≤10 km 96

454 georeferenced · 53 without coordinates

Open the mapobservation + sensor507

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 117≤1 km 126≤10 km 52>10 km 17

312 georeferenced · 197 without coordinates

Open the institutions mapphysical evidence509

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	123
Luhanskyi Nature Reserve, Stanychno-Luhanskyi Division,location not on record	53
State Museum of Nature History, Lvivlocation not on record	42
Helsinki, FI	32
Uniwersytet Wrocławskilocation not on record	16
Tilburg, NL	15
Copenhagen, DK	13
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	13
Adam Mickiewicz University in Poznańlocation not on record	12
Metsähallituslocation not on record	12
NHMOlocation not on record	11
ZSMlocation not on record	10
Trondheim, NO	10
CBDClocation not on record	10
Tallinn, EE	8
NTNU-VMlocation not on record	5
MZLUlocation not on record	5
NMOKlocation not on record	5
Akademia Pomorska w Słupskulocation not on record	5
T.G. Shevchenko National University, Zoological Museum, Kyivlocation not on record	4
ZMAAlocation not on record	4
BioFokuslocation not on record	4
Natural History Museum Rotterdamlocation not on record	3
NCMGlocation not on record	3
Salzburg, AT	3
LSMlocation not on record	2
NMBU:MINAlocation not on record	2
neflocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
IFR-DNFlocation not on record	2
Muzeum Górnośląskie w Bytomiulocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Tartu, EE	1
TMPMlocation not on record	1
Kuopio, FI	1
Olocation not on record	1
Jyväskylä, FI	1
Natural History Museum, Londonlocation not on record	1

38 institutions · 439 of 509 vouchered records shown · 70 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA34 detections

Where the DNA of Dinaraea angustula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys4

Countries5

Verifiable raw sequence linked18

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map5 countries0

14. Artificial - Terrestrial|14.1 Arable Land

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 6.10–17.6

Seasonal swing summer↔winter17.5 °C

Max temp (day)16.9 °C 9.90–20.8

Min temp (night)10.6 °C 1.50–13.4

Precipitation61.4 mm/mo 34.5–79.9

Air humidity60.1 % 57.6–61.5

Moisture balance-59.1 mm/mo -75.1–24.0

Vapour deficit643 Pa 362–829

Wind speed3.90 m/s 3.30–4.80

Cloud cover43.7 % 38.5–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dinaraea angustula

At a glance

Sources7 archives

At a glance

Record type1 021 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 38 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 021 records