Aleochara bimaculata

Gravenhorst, 1802 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Aleochara

At a glance

Occurrence records24

Data sources6

Biological traits0

DNA specimens11

eDNA detections6

Sources6 archives

Databases and archives Aleochara bimaculata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF24 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD11 specimens

01Narrative

Aleochara bimaculata (лат.) — вид коротконадкрылых жуков из подсемейства Aleocharinae. Новый Свет.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aleochara bimaculata has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

85Avariable

AACCTTATATTTTATTTTTGGAGCTTGAGCAGGAATAGTAGGAACATCTTTAAGACTATTAATTCGTGCTGAATTAGGTAATCCAGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aleochara vernasame genus10.2%Aleochara curtulasame genus10.3%Acrotona parvulasame family10.3%Aleochara sulcicollissame genus10.5%Bradybaenus scalarissame order11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type24 records

Wild obs. + sensor1

Museum / vouchered23

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 1>10 km 2

4 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	10
Tapachula, MX	6
Chicago, US	2
Santa Barbara Museum of Natural Historylocation not on record	2
Helsinki, FI	1
Natural History Museum, Londonlocation not on record	1
Universidad Católica de Manizaleslocation not on record	1

7 institutions · 23 of 23 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Aleochara bimaculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 11.9–22.3

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C 16.3–30.0

Min temp (night)8.20 °C 8.10–14.7

Precipitation79.6 mm/mo 16.5–159

Air humidity57.3 % 47.0–61.3

Moisture balance-38.4 mm/mo -148–68.7

Vapour deficit733 Pa 563–1,542

Wind speed2.70 m/s 1.30–5.20

Cloud cover36.7 % 18.0–51.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)