Aleochara verna

Say, 1833 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Aleochara

At a glance

Occurrence records374

Data sources6

Biological traits0

DNA specimens126

eDNA detections132

Sources6 archives

Databases and archives Aleochara verna's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility374 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI132 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics126 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF374 records

Environmental DNA3 datasets · 6 countries132 detections

DNA & barcodingBOLD126 specimens

01Narrative

Aleochara verna (лат.) — вид коротконадкрылых жуков из подсемейства Aleocharinae. Имеет экономическое значение в биологической борьбе с сельскохозяйственными вредителями капусты и зерновых культур. Северная Америка.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding126 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aleochara verna has left across the world's sequence archives.

At a glance

DNA specimens126

BINs3

Marker genes1

eDNA detections132

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus80 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

31Tmostly conserved

79Amostly conserved

82Cmostly conserved

100Tmostly conserved

154Cmostly conserved

289Amostly conserved

290Cmostly conserved

622Gmostly conserved

TACCTTATATTTTATTTTTGGAGCTTGAGCTGGAATAGTAGGAACATCCCTTAGATTATTAATTCGAGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes8

BINs3

Most divergent pair9.9%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aleochara suffusasame genus7.3%Aleochara shelleyaesame genus7.9%Aleochara brundinisame genus7.9%Aleochara bilineatasame genus8.2%Aleochara bipustulatasame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type374 records

Wild obs. + sensor100

Museum / vouchered264

Other10

Origin

Introduced3

Range

Area of Occupancy AOO812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 43≤1 km 30≤10 km 23

96 georeferenced · 4 without coordinates

Open the mapobservation + sensor100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 58≤1 km 49≤10 km 31

138 georeferenced · 126 without coordinates

Open the institutions mapphysical evidence264

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	50
UAclocation not on record	34
University of Guelph, Centre for Biodiversity Genomicslocation not on record	32
Edmonton, CA	18
Royal Saskatchewan Museumlocation not on record	14
Provincia di Livornolocation not on record	12
WIlocation not on record	9
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	7
University of Guelphlocation not on record	4
ZSMlocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	2
University of Alaska Museumlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Salzburg, AT	1
IFR-DNFlocation not on record	1
Tromsø, NO	1
Copenhagen, DK	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
ZMAAlocation not on record	1

19 institutions · 194 of 264 vouchered records shown · 70 without an institution code

09Environmental DNA132 detections

Where the DNA of Aleochara verna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found132

Studies independent surveys3

Countries6

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 132 detections have coordinates

Open the map6 countries0

GrasslandWetlandForest1. Forest & Woodland|1.4. Temperate ForestSandy beach14. Artificial - Terrestrial|14.5 Urban Areas

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 12.5–19.1

Seasonal swing summer↔winter20.5 °C

Max temp (day)18.8 °C 17.5–26.8

Min temp (night)7.40 °C 6.80–13.7

Precipitation67.7 mm/mo 4.80–145

Air humidity55.3 % 37.5–61.5

Moisture balance-50.8 mm/mo -177–3.30

Vapour deficit663 Pa 627–1,218

Wind speed2.70 m/s 2.20–4.40

Cloud cover38.9 % 13.6–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 128 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)