Diaphania glauculalis

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Diaphania

At a glance

Occurrence records217

Data sources5

Biological traits0

DNA specimens114

eDNA detections119

Sources5 archives

Databases and archives Diaphania glauculalis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility217 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI119 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics114 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF217 records

Environmental DNA1 datasets · 9 countries119 detections

DNA & barcodingBOLD114 specimens

01Narrative

Diaphania glauculalis is a moth in the family Crambidae. It was described by Achille Guenée in 1854. It is found in Haiti, Costa Rica, Panama and Ecuador.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding114 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diaphania glauculalis has left across the world's sequence archives.

At a glance

DNA specimens114

BINs1

Marker genes1

eDNA detections119

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus112 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

23Gmostly conserved

92Tmostly conserved

166Amostly conserved

337Cvariable

370Gmostly conserved

439Cmostly conserved

TACTTTATATTTTATTTTTGGTGTTTGAGCAGGAATAGTAGGAACATCTCTTAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.32%

Haplotypes20

BIN1

Most divergent pair0.91%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agathodes ostentalissame family6.8%Cydalima diaphanalissame family6.8%Glyphodes stolalissame family7.1%Pygospila tyressame family7.4%Lamprosema victoriaesame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type217 records

Wild obs. + sensor8

Museum / vouchered209

Range

Area of Occupancy AOO240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 7

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 205 without coordinates

Open the institutions mapphysical evidence209

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	121
New Haven, US	4
Mississippi State, US	3
University of Pennsylvanialocation not on record	2
Research Collection of D. H. Janzen & W. Hallwachslocation not on record	1

5 institutions · 131 of 209 vouchered records shown · 78 without an institution code

09Environmental DNA119 detections

Where the DNA of Diaphania glauculalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found119

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 119 detections have coordinates

Open the map9 countries0

Forestlittoral-arid1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.1–25.5

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.5 °C 25.5–29.2

Min temp (night)21.7 °C 20.7–23.6

Precipitation247 mm/mo 58.7–406

Air humidity69.9 % 64.9–73.9

Moisture balance93.6 mm/mo -101–261

Vapour deficit932 Pa 756–1,128

Wind speed2.20 m/s 1.20–4.00

Cloud cover30.5 % 15.1–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 114 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)