Coronidia orithea

Cramer, 1780 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sematuridae/Coronidia

At a glance

Occurrence records56

Data sources6

Biological traits0

DNA specimens22

eDNA detections16

Sources6 archives

Databases and archives Coronidia orithea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF56 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD22 specimens

01Narrative

Coronidia orithea is a moth of the family Sematuridae. It is known from the Neotropics, including Surinam, French Guiana, and Peru. The larvae feed on Phoradendron quadrangulare.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coronidia orithea has left across the world's sequence archives.

At a glance

DNA specimens22

BINs3

Marker genes5

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

10Cmostly conserved

40Gvariable

49Tmostly conserved

50Cmostly conserved

70Amostly conserved

76Amostly conserved

82Cmostly conserved

92Tmostly conserved

115Tmostly conserved

127Amostly conserved

133Tmostly conserved

136Cmostly conserved

139Gmostly conserved

157Cmostly conserved

166Gmostly conserved

202Avariable

206Tmostly conserved

214Amostly conserved

229Amostly conserved

268Cmostly conserved

355Tmostly conserved

361Tmostly conserved

382Cmostly conserved

400Amostly conserved

442Tmostly conserved

463Cmostly conserved

532Cmostly conserved

536Tmostly conserved

542Tmostly conserved

557Tmostly conserved

562Amostly conserved

578Cmostly conserved

580Tmostly conserved

581Tmostly conserved

616Cmostly conserved

625Amostly conserved

628Amostly conserved

641Tmostly conserved

652Tmostly conserved

AACATTATACTTTATTTTTGGTATTTGAGCAGGAATAGTGGGAACATCTCTAAGTTTACTAATTCGAGCAGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes6

BINs3

Most divergent pair4.7%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis porphyricollissame order8.5%Dichagyris celsicolasame order8.7%Actebia fugaxsame order8.8%Euxoa agricolasame order8.9%Paradiarsia littoralissame order9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S28SEF1-alpha

animal barcoderibosomalmarker

08Occurrence & distribution

Record type56 records

Wild obs. + sensor37

Museum / vouchered19

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 10≤1 km 11≤10 km 4>10 km 4

29 georeferenced · 8 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 4≤10 km 5

9 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	5
Ciudad de México, MX	4
Mississippi State, US	1
University of Marylandlocation not on record	1

4 institutions · 11 of 19 vouchered records shown · 8 without an institution code

09Environmental DNA16 detections

Where the DNA of Coronidia orithea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 25.2–25.6

Seasonal swing summer↔winter2.00 °C

Max temp (day)27.6 °C 27.1–27.6

Min temp (night)23.9 °C 22.1–24.0

Precipitation229 mm/mo 154–342

Air humidity69.0 % 65.7–71.1

Moisture balance61.2 mm/mo -9.70–193

Vapour deficit1,006 Pa 924–1,090

Wind speed3.30 m/s 2.60–4.00

Cloud cover34.2 % 29.0–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)