Contusus richei

(Fréminville, 1813) · species

image placeholder — illustration coming later

Animalia/Chordata/Tetraodontiformes/Tetraodontidae/Contusus

At a glance

Occurrence records1 130

Data sources8

Biological traits8

DNA specimens4

eDNA detections0

Sources8 archives

Databases and archives Contusus richei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility563 records↗

OBISOcean Biodiversity Information System567 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF · OBIS1 130 records

DNA & barcodingBOLD4 specimens

01Narrative

The prickly toadfish (Contusus richei) is a pufferfish of the family Tetraodontidae, found in the eastern Indian Ocean and the southwest Pacific Ocean, at depths down to 50 m. Its length is up to 25 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAnAgeFishBase

Size & morphology1

Body length25.4 cm

Life cycle & reproduction1

Max. longevity84 months

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max50 m

Depth min1 m

Vulnerability37.21

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Contusus richei has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

16Cmostly conserved

22Cmostly conserved

58Cvariable

94Avariable

142Avariable

184Cvariable

208Avariable

394Cvariable

415Cvariable

421Avariable

448Avariable

490Avariable

508Avariable

541Cvariable

CCTTTATCTAATTTTCGGTGCCTGAGCAGGCATAGTGGGGACAGCCCTTAGCCTCCTCATCCGGGCTGAACTAAGCCAACCAGGAGCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes3

BINs2

Most divergent pair2.0%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Contusus brevicaudussame genus15.3%Atypichthys strigatussame order16.0%Kyphosus sectatrixsame order16.3%Marilyna darwiniisame family16.6%Siniperca undulatasame order16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 130 records

Wild obs. + sensor896

Museum / vouchered233

Other1

Origin

Native6

Range

Area of Occupancy AOO1 608 km²

Depth

0–200 m sunlit440

200–1000 m twilight11

1–4 km midnight0

>4 km abyssal0

median 22.7 m · max 340 m · 451 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 439≤1 km 429≤10 km 13>10 km 3

884 georeferenced · 12 without coordinates

Open the mapobservation + sensor896

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 7≤1 km 59≤10 km 35>10 km 2

103 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence233

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	29
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	19
Sydney, AU	11
Australian National Fish Collectionlocation not on record	10
QVMAGlocation not on record	10
Auckland, NZ	9
	4
Natick, US	3
Stockholm, SE	2
Tasmanian Museum & Art Gallerylocation not on record	2
Cambridge, US	1
FishBaselocation not on record	1
Toronto, CA	1

13 institutions · 102 of 233 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Contusus richei

At a glance

Sources8 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type1 130 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 13 geolocated

Record type1 130 records