Contusus brevicaudus

Hardy, 1981 · species

image placeholder — illustration coming later

Animalia/Chordata/Tetraodontiformes/Tetraodontidae/Contusus

At a glance

Occurrence records1 100

Data sources9

Biological traits6

DNA specimens12

eDNA detections12

Sources9 archives

Databases and archives Contusus brevicaudus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility582 records↗

OBISOcean Biodiversity Information System518 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 100 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Contusus brevicaudus, known as the prickly toadfish (a name also used for the closely related species C. richei), is a species of pufferfish in the family Tetraodontidae. It is known only from Australia, ranging from Western Australia to New South Wales, including Tasmania. It is a nocturnal species that inhabits estuaries and marine waters and is usually seen at depths of less than 20 m (66 ft). It reaches 25 cm (9.8 inches) in total length.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length25 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonedemersal

Other traits2

Depth max20 m

Vulnerability15

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Contusus brevicaudus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections12

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

2Cmostly conserved

3Tmostly conserved

4Cmostly conserved

5Tmostly conserved

6Amostly conserved

7Tmostly conserved

8Cmostly conserved

10Amostly conserved

11Amostly conserved

13Cmostly conserved

14Tmostly conserved

15Tmostly conserved

18Gmostly conserved

19Tmostly conserved

20Gmostly conserved

21Cmostly conserved

22Cmostly conserved

23Tmostly conserved

24Gmostly conserved

27Cmostly conserved

28Amostly conserved

29Gmostly conserved

30Gmostly conserved

31Tmostly conserved

32Amostly conserved

36Tmostly conserved

37Gmostly conserved

38Gmostly conserved

39Gmostly conserved

41Amostly conserved

43Amostly conserved

44Gmostly conserved

45Cmostly conserved

46Cmostly conserved

47Cmostly conserved

48Tmostly conserved

49Tmostly conserved

50Amostly conserved

51Gmostly conserved

52Cmostly conserved

55Tmostly conserved

178Cmostly conserved

337Cmostly conserved

391Tmostly conserved

508Gmostly conserved

514Tmostly conserved

CCTCTATCTAATCTTTGGTGCCTGAGCAGGTATGGTGGGAACAGCCCTTAGCCTTCTCATCCGAGCTGAACTTAGCCAACCCGGGGCGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes5

BIN1

Most divergent pair6.9%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Contusus richeisame genus15.3%Sargocentron tieresame order16.4%Sargocentron spiniferumsame order16.6%Protomyctophum andriashevisame order16.7%Sargocentron caudimaculatumsame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 100 records

Wild obs. + sensor584

Museum / vouchered508

Other8

Origin

Native32

Range

Area of Occupancy AOO1 184 km²

Depth

0–200 m sunlit158

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 12 m · max 64 m · 158 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 160≤1 km 240≤10 km 8>10 km 5

413 georeferenced · 171 without coordinates

Open the mapobservation + sensor584

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 14≤1 km 138≤10 km 29>10 km 24

205 georeferenced · 303 without coordinates

Open the institutions mapphysical evidence508

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	93
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	31
Australian National Fish Collectionlocation not on record	30
Sydney, AU	28
Western Australian Museumlocation not on record	14
QVMAGlocation not on record	1
University of California San Diegolocation not on record	1

7 institutions · 198 of 508 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Contusus brevicaudus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 11.8–21.5

Seasonal swing summer↔winter7.80 °C

Max temp (day)17.9 °C 13.9–25.5

Min temp (night)12.6 °C 9.70–18.5

Precipitation46.7 mm/mo 11.6–69.2

Air humidity57.2 % 54.7–58.8

Vapour deficit721 Pa 572–1,159

Cloud cover21.6 % 16.2–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Contusus brevicaudus

At a glance

Sources9 archives

Size & morphology1

Habitat & environment3

Other traits2

At a glance

Record type1 100 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 100 records