Clavus exasperatus

(Reeve, 1843) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Neogastropoda/Drilliidae/Clavus

At a glance

Occurrence records120

Data sources8

Biological traits2

DNA specimens4

eDNA detections2

Sources8 archives

Databases and archives Clavus exasperatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility82 records↗

OBISOcean Biodiversity Information System38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS120 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD4 specimens

01Narrative

Clavus exasperatus, common name the exasperating turrid, is a species of sea snail, a marine gastropod mollusk in the family Drilliidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Clavus exasperatus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs3

Marker genes1

eDNA detections2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 74 variable positions, in barcode order

4Gvariable

10Cvariable

19Tvariable

25Avariable

35Tvariable

52Amostly conserved

55Amostly conserved

61Amostly conserved

67Amostly conserved

76Amostly conserved

79Tmostly conserved

85Tmostly conserved

91Amostly conserved

92Tmostly conserved

118Cvariable

145Avariable

151Cmostly conserved

157Tmostly conserved

166Amostly conserved

169Gvariable

178Cmostly conserved

184Cvariable

193Cvariable

205Avariable

212Tmostly conserved

214Avariable

220Cmostly conserved

238Gmostly conserved

259Tmostly conserved

265Amostly conserved

268Amostly conserved

271Tmostly conserved

280Cvariable

301Tmostly conserved

307Avariable

313Avariable

322Tmostly conserved

325Tmostly conserved

331Amostly conserved

343Tmostly conserved

355Amostly conserved

358Tmostly conserved

373Cvariable

382Amostly conserved

385Cmostly conserved

388Amostly conserved

391Avariable

397Cvariable

401Cmostly conserved

403Avariable

409Cmostly conserved

421Gvariable

428Tmostly conserved

439Amostly conserved

445Tmostly conserved

457Cvariable

460Tmostly conserved

463Tmostly conserved

481Amostly conserved

484Gmostly conserved

487Tmostly conserved

494Cvariable

499Avariable

508Amostly conserved

529Cvariable

535Gmostly conserved

541Amostly conserved

547Tmostly conserved

550Avariable

578Tmostly conserved

583Avariable

601Cvariable

643Amostly conserved

649Amostly conserved

AACGTTATACATTTTATTTGGAATATGATCCGGATTAGTTGGAACTGCATTAAGACTTTTAATTCGAGCTGAATTAGGTCAACCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.4%

Haplotypes3

BINs3

Most divergent pair7.9%

AfricaOceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Clavus canalicularissame genus5.8%Clavus rugizonatussame genus6.4%Clavus obliquicostatussame genus10.5%Neverita didymasame order13.5%Lophiotoma abbreviatasame order14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type120 records

Wild obs. + sensor9

Museum / vouchered107

Other4

Range

Area of Occupancy AOO224 km²

Depth

0–200 m sunlit6

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 16.5 m · max 146 m · 6 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤1 km 1>10 km 6

7 georeferenced · 2 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 3≤1 km 21≤10 km 8>10 km 23

55 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence107

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	30
Brussels, BE	9
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Santa Barbara Museum of Natural Historylocation not on record	4
RBINS-Scientific Heritagelocation not on record	4
USPac-SMSlocation not on record	3
Paris, FR	3
Museum and Art Gallery of the Northern Territorylocation not on record	2
Western Australian Museumlocation not on record	2
Wakayama Prefectural Museum of Natural Historylocation not on record	1
NTNU-VMlocation not on record	1
Denver, US	1
Philadelphia, US	1
CASlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Toyohashi Museum Of Natural Historylocation not on record	1
Delaware Museum of Nature and Sciencelocation not on record	1
Champaign, US	1

18 institutions · 70 of 107 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Clavus exasperatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 23.1–23.1

Seasonal swing summer↔winter5.40 °C

Max temp (day)24.5 °C 24.4–24.7

Min temp (night)21.7 °C

Precipitation130 mm/mo 95.1–164

Air humidity62.9 % 62.5–63.4

Vapour deficit1,049 Pa 1,035–1,062

Cloud cover32.0 % 30.3–33.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)