Cimbex femoratus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cimbicidae/Cimbex

At a glance

Occurrence records4 083

Data sources8

Biological traits0

DNA specimens20

eDNA detections515

Sources8 archives

Databases and archives Cimbex femoratus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 083 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI515 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 083 records

Environmental DNA3 datasets · 4 countries515 detections

DNA & barcodingBOLD20 specimens

Genome at a glanceGoaT2n = 16

01Narrative

Cimbex femoratus, the birch sawfly, is a species of sawflies in the family Cimbicidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cimbex femoratus has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections515

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 44 variable positions, in barcode order

22Tmostly conserved

49Tmostly conserved

50Amostly conserved

76Tmostly conserved

79Amostly conserved

86Tmostly conserved

88Tmostly conserved

133Tmostly conserved

140Tmostly conserved

151Cmostly conserved

160Amostly conserved

179Gmostly conserved

195Tmostly conserved

202Tmostly conserved

203Cmostly conserved

213Gmostly conserved

223Cmostly conserved

232Cmostly conserved

237Gmostly conserved

241Amostly conserved

253Amostly conserved

277Cmostly conserved

283Tmostly conserved

284Cmostly conserved

313Avariable

330Cmostly conserved

336Amostly conserved

340Amostly conserved

364Cmostly conserved

365Gmostly conserved

416Tmostly conserved

427Tmostly conserved

430Gmostly conserved

440Tmostly conserved

475Tmostly conserved

487Tmostly conserved

496Cmostly conserved

517Amostly conserved

527Tmostly conserved

559Tmostly conserved

575Tmostly conserved

625Avariable

627Gmostly conserved

633Cmostly conserved

TTTATATTTTATTTTTGGATTTTGATCAGGAATATTAGGTTTATCATTTAGAATAATTATTCGAACTGAATTAGGTACACCAGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes5

BINs2

Most divergent pair5.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cimbex luteussame genus4.3%Cimbex connatussame genus4.5%Trichiosoma sibiricumsame family10.6%Trichiosoma vitellinasame family10.9%Trichiosoma aenescenssame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Cimbex femoratus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type4 083 records

Wild obs. + sensor3 672

Museum / vouchered407

Other4

Range

Area of Occupancy AOO13 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 1 829≤1 km 694≤10 km 613>10 km 111

3 247 georeferenced · 425 without coordinates

Open the mapobservation + sensor3 672

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 71≤1 km 81≤10 km 135>10 km 4

291 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence407

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	33
Muzeum Górnośląskie w Bytomiulocation not on record	23
Provincia di Livornolocation not on record	22
ZMAAlocation not on record	22
Tartu, EE	21
Gothenburg, SE	21
Zürich, CH	19
NTNU-VMlocation not on record	18
SLU Artdatabankenlocation not on record	17
Tilburg, NL	16
Kushiro City Museumlocation not on record	15
Bonn, DE	13
Helsinki, FI	10
Oulu, FI	10
Philadelphia, US	8
BioFokuslocation not on record	6
Natural History Museum Rotterdamlocation not on record	6
Nijmegen, NL	4
Saint John, CA	4
South Kensington, GB	4
ZSMlocation not on record	3
Private Collection of H. Haraldseidelocation not on record	3
Stockholm, SE	2
Bavarian State Collection of Zoologylocation not on record	2
Natural History Museum, Londonlocation not on record	2
Metsähallituslocation not on record	1
Ugentlocation not on record	1
NCMGlocation not on record	1
CBDClocation not on record	1
NEFlocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
neflocation not on record	1

32 institutions · 311 of 407 vouchered records shown · 96 without an institution code

09Environmental DNA515 detections

Where the DNA of Cimbex femoratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found515

Studies independent surveys3

Countries4

Verifiable raw sequence linked512

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 515 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 15.9–17.2

Seasonal swing summer↔winter17.1 °C

Max temp (day)19.9 °C 18.4–20.7

Min temp (night)13.2 °C 12.8–15.9

Precipitation69.0 mm/mo 55.2–76.7

Air humidity61.3 % 61.1–62.9

Moisture balance-60.7 mm/mo -70.1–-8.90

Vapour deficit728 Pa 700–754

Wind speed4.00 m/s 2.50–5.50

Cloud cover43.5 % 40.6–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 515 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cimbex femoratus

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 083 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 083 records