Cimbex connatus

(Schrank, 1776) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cimbicidae/Cimbex

At a glance

Occurrence records1 138

Data sources7

Biological traits0

DNA specimens13

eDNA detections6

Sources7 archives

Databases and archives Cimbex connatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 138 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 138 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD13 specimens

01Narrative

The larvae of the Çimbex connatus, feed on species of the genus Alnus Cimbex connatus, also known by its common name large alder sawfly is a species from the genus Cimbex.Cimbex connatus (Schrank, 1776) in GBIF Secretariat (2021). GBIF Backbone Taxonomy. Checklist dataset https://doi.org/10.15468/39omei accessed via GBIF.org on 2021-06-01. The species was originally described by Franz Paula von Schrank in 1776.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cimbex connatus has left across the world's sequence archives.

At a glance

DNA specimens13

BINs3

Marker genes1

eDNA detections6

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 62 variable positions, in barcode order

15Cmostly conserved

21Cmostly conserved

36Amostly conserved

41Tmostly conserved

48Cmostly conserved

63Avariable

65Cvariable

72Amostly conserved

75Amostly conserved

78Cmostly conserved

87Amostly conserved

88Cmostly conserved

111Tmostly conserved

132Cmostly conserved

139Tmostly conserved

150Tmostly conserved

153Tmostly conserved

170Tmostly conserved

184Gmostly conserved

192Amostly conserved

201Tmostly conserved

202Tmostly conserved

203Gvariable

213Amostly conserved

266Cmostly conserved

267Cvariable

276Tmostly conserved

282Cmostly conserved

283Tmostly conserved

285Amostly conserved

286Cmostly conserved

308Cmostly conserved

312Tmostly conserved

339Cvariable

344Gvariable

364Amostly conserved

393Cmostly conserved

413Tmostly conserved

414Cmostly conserved

426Amostly conserved

429Tmostly conserved

436Amostly conserved

441Tmostly conserved

473Cmostly conserved

474Amostly conserved

486Tvariable

489Avariable

490Cmostly conserved

492Amostly conserved

495Amostly conserved

501Tmostly conserved

516Tmostly conserved

526Cmostly conserved

536Tmostly conserved

545Tmostly conserved

558Amostly conserved

574Tmostly conserved

585Tmostly conserved

594Avariable

612Tmostly conserved

630Tmostly conserved

644Amostly conserved

TTATATTTTATTTTCGGATTCTGATCAGGAATATTAGGTTTATCATTCAGAATAATTATTCGAACTGAATTAGGAACCCCAGGATCACTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes3

BINs3

Most divergent pair8.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cimbex femoratussame genus4.5%Cimbex luteussame genus4.5%Trichiosoma sibiricumsame family10.9%Trichiosoma vitellinasame family11.2%Trichiosoma lucorumsame family11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 138 records

Wild obs. + sensor1 008

Museum / vouchered124

Other6

Range

Area of Occupancy AOO3 888 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 495≤1 km 163≤10 km 152>10 km 30

840 georeferenced · 168 without coordinates

Open the mapobservation + sensor1 008

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 9≤1 km 29≤10 km 43

81 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence124

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	12
Zürich, CH	11
Provincia di Livornolocation not on record	10
Natural History Museum Rotterdamlocation not on record	7
Tartu, EE	6
NHMOlocation not on record	6
Helsinki, FI	5
Gothenburg, SE	5
Bavarian State Collection of Zoologylocation not on record	5
ZSMlocation not on record	4
Oulu, FI	4
MZLUlocation not on record	4
SLU Artdatabankenlocation not on record	3
Stockholm, SE	2
Bonn, DE	2
BioFokuslocation not on record	1
Nijmegen, NL	1
Philadelphia, US	1
Kushiro City Museumlocation not on record	1
neflocation not on record	1
Natural History Museum, Londonlocation not on record	1
University of Oululocation not on record	1
South Kensington, GB	1

23 institutions · 94 of 124 vouchered records shown · 30 without an institution code

09Environmental DNA6 detections

Where the DNA of Cimbex connatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 8.70–17.5

Seasonal swing summer↔winter24.8 °C

Max temp (day)20.2 °C 11.5–21.1

Min temp (night)13.1 °C 5.50–14.4

Precipitation67.0 mm/mo 49.9–85.2

Air humidity60.1 % 59.0–63.2

Moisture balance-36.6 mm/mo -68.9–-16.6

Vapour deficit784 Pa 507–800

Wind speed3.80 m/s 2.50–4.50

Cloud cover45.9 % 41.2–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cimbex connatus

At a glance

Sources7 archives

At a glance

Record type1 138 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 138 records