Chrysoteuchia culmella

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Chrysoteuchia

At a glance

Occurrence records165 399

Data sources9

Biological traits0

DNA specimens137

eDNA detections1 060

Sources9 archives

Databases and archives Chrysoteuchia culmella's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility165 399 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 060 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics137 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF165 399 records

Environmental DNA6 datasets · 16 countries1 060 detections

DNA & barcodingBOLD137 specimens

Genome at a glanceGoaT · NCBI≈645 Mbp

01Narrative

Chrysoteuchia culmella, the garden grass-veneer, is a species of moth of the family Crambidae. It was first described by Carl Linnaeus in his 1758 10th edition of Systema Naturae. It is found in Europe. Fig. 4 larva after final moult The wingspan is 18–24 mm. The forewings are brown ; a whitish median streak, ending in branches along veins 2-5, often separated by dark fuscous scales ; dorsal 2/3 often wholly suffused with whitish-ochreous ; a terminal series of black dots ; cilia metallic. Hindwings are rather dark grey. The larva is pale pinkish-ochreous ; spots brown ; head and plate of 2 brown, darker- marked.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The moth flies from June to July depending on the location. The larvae feed on various grasses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding137 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysoteuchia culmella has left across the world's sequence archives.

At a glance

DNA specimens137

BINs2

Marker genes1

eDNA detections1 060

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus135 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

160Amostly conserved

235Tmostly conserved

400Tvariable

409Gvariable

415Amostly conserved

439Cmostly conserved

554Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes10

BINs2

Most divergent pair1.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Crambus attissame family7.1%Bradina geminalissame family7.3%Fernandocrambus harpipterussame family7.6%Psilocorsis quercicellasame order7.8%Decantha steciasame order7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Chrysoteuchia culmella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈645 211 292 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Chrysoteuchia culmella0.65 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.6% BUSCO

08Occurrence & distribution

Record type165 399 records

Wild obs. + sensor159 588

Museum / vouchered5 402

Cultivated / captive1

Other408

Origin

Native420

Range

Area of Occupancy AOO103 324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 47 546≤1 km 15 372≤10 km 78 013>10 km 739

141 670 georeferenced · 17 918 without coordinates

Open the mapobservation + sensor159 588

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 2 064≤1 km 1 338≤10 km 928>10 km 566

4 896 georeferenced · 506 without coordinates

Open the institutions mapphysical evidence5 402

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	1 576
DanishLepidopterologicalSocietylocation not on record	1 299
Provincia di Livornolocation not on record	312
NHMOlocation not on record	212
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	205
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	179
NTNU-VMlocation not on record	177
Tartu, EE	161
SLU Artdatabankenlocation not on record	84
Zürich, CH	74
Philadelphia, US	64
Salzburg, AT	61
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	56
Stockholm, SE	45
Tromsø, NO	44
Natural History Museum Rotterdamlocation not on record	29
MZLUlocation not on record	26
DABUHlocation not on record	24
Rovaniemi, FI	23
Nijmegen, NL	21
Kuopio, FI	18
Adam Mickiewicz University in Poznańlocation not on record	15
Metsähallituslocation not on record	13
Uniwersytet Łódzkilocation not on record	12
neflocation not on record	10
New Haven, US	10
CBDClocation not on record	10
Cambridge, US	8
Tallinn, EE	8
ZMAAlocation not on record	7
South Kensington, GB	5
BioFokuslocation not on record	5
Brussels, BE	4
University of Kaiserslauternlocation not on record	3
ZSMlocation not on record	2
NMBU:MINAlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
RMZlocation not on record	1
SZOPKlocation not on record	1
Landesmuseum Kärntenlocation not on record	1
Ghent, BE	1
Trondheim, NO	1

42 institutions · 4 811 of 5 402 vouchered records shown · 591 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 060 detections

Where the DNA of Chrysoteuchia culmella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 060

Studies independent surveys6

Countries16

Verifiable raw sequence linked923

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 060 detections have coordinates

Open the map16 countries0

inside forestFloodplain forestprivate gardenflooded meadow, salix treesDunes14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 13.2–17.2

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.5 °C 16.0–20.9

Min temp (night)10.8 °C 9.20–13.8

Precipitation75.2 mm/mo 42.2–92.1

Air humidity59.6 % 57.7–61.5

Moisture balance-43.6 mm/mo -87.0–-15.0

Vapour deficit683 Pa 606–792

Wind speed3.30 m/s 2.20–4.30

Cloud cover45.7 % 38.6–56.6

CHELSA 1981–2010, ~9 km grid, at location & month of 1 058 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chrysoteuchia culmella

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type165 399 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 42 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type165 399 records