Chrysobothris sexsignata

(Say, 1839) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Chrysobothris

At a glance

Occurrence records724

Data sources8

Biological traits0

DNA specimens17

eDNA detections13

Sources8 archives

Databases and archives Chrysobothris sexsignata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility724 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF724 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD17 specimens

01Narrative

Chrysobothris sexsignata is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysobothris sexsignata has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P435 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

3Tmostly conserved

9Cmostly conserved

12Tmostly conserved

15Tmostly conserved

24Tmostly conserved

30Amostly conserved

48Tmostly conserved

51Cvariable

54Tmostly conserved

60Amostly conserved

61Tmostly conserved

67Cmostly conserved

84Amostly conserved

90Tvariable

93Amostly conserved

99Tmostly conserved

105Amostly conserved

111Tmostly conserved

117Cmostly conserved

132Tmostly conserved

150Avariable

156Tmostly conserved

157Gmostly conserved

162Cmostly conserved

163Cmostly conserved

165Tmostly conserved

184Tmostly conserved

198Amostly conserved

204Tvariable

205Cmostly conserved

207Tmostly conserved

216Tmostly conserved

231Tmostly conserved

246Tmostly conserved

259Tmostly conserved

270Amostly conserved

276Amostly conserved

285Amostly conserved

297Amostly conserved

303Amostly conserved

306Tmostly conserved

307Cmostly conserved

313Cmostly conserved

315Tmostly conserved

316Tmostly conserved

318Amostly conserved

319Tmostly conserved

321Amostly conserved

324Tmostly conserved

330Amostly conserved

339Tmostly conserved

345Tvariable

351Tmostly conserved

355Cmostly conserved

357Tmostly conserved

399Amostly conserved

402Amostly conserved

405Amostly conserved

408Avariable

411Cmostly conserved

430Cmostly conserved

GATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCCTCTTTAACATTTCTTCTAATAAGAAGAATTGTAGAAAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes9

BIN1

Most divergent pair12.9%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysobothris azureasame genus4.4%Chrysobothris igniventrissame genus5.7%Chrysobothris chrysostigmasame genus8.5%Chrysobothris affinissame genus8.7%Chrysobothris malisame genus11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type724 records

Wild obs. + sensor128

Museum / vouchered596

Range

Area of Occupancy AOO1 072 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 70≤1 km 14≤10 km 7>10 km 13

104 georeferenced · 24 without coordinates

Open the mapobservation + sensor128

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 4≤1 km 2≤10 km 14>10 km 7

27 georeferenced · 569 without coordinates

Open the institutions mapphysical evidence596

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	268
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	130
St. Paul, US	111
SOVTlocation not on record	21
Lubbock, US	20
WIlocation not on record	19
Lexington, US	7
University Park, US	6
MAJClocation not on record	3
University of Central Floridalocation not on record	2
Wuzhou, CN	2
Washington, US	1
Canadian Forest Service, Laurentian Forestry Centrelocation not on record	1
Champaign, US	1
CUlocation not on record	1
Denver, US	1
Espace pour la vielocation not on record	1
University of Alberta Museums (UAM)location not on record	1

18 institutions · 596 of 596 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Chrysobothris sexsignata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 16.1–22.0

Seasonal swing summer↔winter29.8 °C

Max temp (day)24.3 °C 20.5–26.2

Min temp (night)15.7 °C 11.8–19.4

Precipitation93.0 mm/mo 88.2–163

Air humidity59.3 % 57.8–60.7

Moisture balance-44.1 mm/mo -75.1–43.9

Vapour deficit923 Pa 751–1,122

Wind speed2.80 m/s 2.50–3.50

Cloud cover43.4 % 37.5–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)