Chrysobothris cribraria

Mannerheim, 1837 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Chrysobothris

At a glance

Occurrence records123

Data sources10

Biological traits0

DNA specimens12

eDNA detections8

Sources10 archives

Databases and archives Chrysobothris cribraria's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility123 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF123 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD12 specimens

Genome at a glanceGoaT · TreeOfSex2n = 16

01Narrative

Chrysobothris cribraria is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysobothris cribraria has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P435 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

43Tmostly conserved

48Tmostly conserved

51Amostly conserved

93Gvariable

117Cvariable

141Cvariable

180Avariable

234Tmostly conserved

251Tmostly conserved

267Cmostly conserved

354Amostly conserved

402Gvariable

411Cvariable

423Cmostly conserved

GATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCATTAACACTTCTTTTAATAAGAAGAATTGTTGAAAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes7

BIN1

Most divergent pair2.5%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysobothris scabripennissame genus5.5%Chrysobothris carinipennissame genus5.7%Chrysobothris dentipessame genus6.2%Chrysobothris leechisame genus6.2%Chrysobothris trinerviasame genus6.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Chrysobothris cribraria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 165×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Karagyan G, Kuznetsova KG (2000) Chromosome numbers and sex chromosome systems in buprestid beetles (Coleoptera, Buprestidae). Entomological Review 80: 38-49. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type123 records

Wild obs. + sensor42

Museum / vouchered81

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 20≤1 km 2≤10 km 6>10 km 4

32 georeferenced · 10 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 1≤10 km 9>10 km 9

19 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Central Floridalocation not on record	32
University of Guelphlocation not on record	23
Lubbock, US	11
St. Paul, US	4
Denver, US	2
ASUlocation not on record	2
CUlocation not on record	1
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	1
Lexington, US	1
University of Vermontlocation not on record	1
Royal Saskatchewan Museumlocation not on record	1
SOVTlocation not on record	1
University Park, US	1

13 institutions · 81 of 81 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Chrysobothris cribraria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 18.1–26.5

Seasonal swing summer↔winter18.2 °C

Max temp (day)29.6 °C 23.1–31.3

Min temp (night)22.4 °C 14.8–22.4

Precipitation91.0 mm/mo 78.2–124

Air humidity59.4 % 59.0–59.9

Moisture balance-76.0 mm/mo -84.1–-53.8

Vapour deficit1,344 Pa 878–1,386

Wind speed3.10 m/s 2.80–4.40

Cloud cover34.2 % 29.1–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)