Chrysobothris trinervia

(Kirby, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Chrysobothris

At a glance

Occurrence records325

Data sources8

Biological traits0

DNA specimens18

eDNA detections20

Sources8 archives

Databases and archives Chrysobothris trinervia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility325 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF325 records

Environmental DNA1 datasets · 2 countries20 detections

DNA & barcodingBOLD18 specimens

01Narrative

Chrysobothris trinervia is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysobothris trinervia has left across the world's sequence archives.

At a glance

DNA specimens18

BINs3

Marker genes1

eDNA detections20

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 80 variable positions, in barcode order

22Amostly conserved

28Amostly conserved

49Tmostly conserved

59Tmostly conserved

79Amostly conserved

133Tmostly conserved

136Cvariable

157Cvariable

181Amostly conserved

184Amostly conserved

190Amostly conserved

193Cvariable

202Gvariable

205Cvariable

217Amostly conserved

229Amostly conserved

235Cvariable

263Tmostly conserved

266Cvariable

268Amostly conserved

271Amostly conserved

274Amostly conserved

278Cvariable

284Cmostly conserved

286Tmostly conserved

292Amostly conserved

295Amostly conserved

307Tmostly conserved

316Avariable

319Amostly conserved

325Amostly conserved

328Amostly conserved

334Amostly conserved

340Tmostly conserved

343Tmostly conserved

346Tmostly conserved

349Amostly conserved

352Tmostly conserved

358Cvariable

364Tmostly conserved

373Amostly conserved

401Cvariable

406Cvariable

412Tmostly conserved

415Avariable

466Amostly conserved

473Gmostly conserved

474Tmostly conserved

475Amostly conserved

478Amostly conserved

499Tmostly conserved

500Tmostly conserved

508Tmostly conserved

514Tmostly conserved

517Amostly conserved

519Cmostly conserved

520Tmostly conserved

529Amostly conserved

535Amostly conserved

539Tmostly conserved

541Avariable

547Amostly conserved

556Tmostly conserved

557Tmostly conserved

562Avariable

565Avariable

568Tmostly conserved

574Tvariable

581Tmostly conserved

583Amostly conserved

589Tmostly conserved

595Tmostly conserved

596Cvariable

598Amostly conserved

616Tmostly conserved

625Avariable

634Tmostly conserved

637Tvariable

649Avariable

653Cvariable

AACATTATATTTTATTTTTGGAGCTTGAGCAGGAATAGTAGGAACTGCTTTAAGACTTTTAATTCGAGCTGAATTAGGAAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes9

BINs3

Most divergent pair5.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysobothris scabripennissame genus3.5%Chrysobothris carinipennissame genus3.6%Chrysobothris leechisame genus3.8%Chrysobothris caurinasame genus5.9%Chrysobothris laricissame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type325 records

Wild obs. + sensor4

Museum / vouchered321

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 10≤1 km 21≤10 km 12>10 km 3

46 georeferenced · 275 without coordinates

Open the institutions mapphysical evidence321

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vernal, US	85
WIlocation not on record	64
Royal Saskatchewan Museumlocation not on record	44
University of Alberta Museums (UAM)location not on record	42
Edmonton, CA	28
University of Guelphlocation not on record	19
Saint John, CA	8
Natural History Museum of Utahlocation not on record	7
St. Paul, US	6
Denver, US	5
MAJClocation not on record	3
Espace pour la vielocation not on record	2
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	1
Universidad Católica de Manizaleslocation not on record	1
SOVTlocation not on record	1

15 institutions · 316 of 321 vouchered records shown · 5 without an institution code

09Environmental DNA20 detections

Where the DNA of Chrysobothris trinervia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

1. Forest|1.2 Subarctic ForestIn spruce/birch wood pileUrbanrocky hilltop, pine and Douglas fir1. Forest & Woodland|1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 10.2–18.9

Seasonal swing summer↔winter35.8 °C

Max temp (day)20.3 °C 14.3–24.0

Min temp (night)10.2 °C 7.00–15.2

Precipitation87.1 mm/mo 39.6–132

Air humidity57.5 % 53.5–61.9

Moisture balance-24.6 mm/mo -88.2–14.3

Vapour deficit823 Pa 471–950

Wind speed2.50 m/s 1.70–3.30

Cloud cover46.4 % 35.6–62.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)