Chrysobothris acutipennis

Chevrolat, 1835 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Chrysobothris

At a glance

Occurrence records188

Data sources8

Biological traits0

DNA specimens44

eDNA detections89

Sources8 archives

Databases and archives Chrysobothris acutipennis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility188 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI89 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF188 records

Environmental DNA1 datasets · 1 countries89 detections

DNA & barcodingBOLD44 specimens

01Narrative

Chrysobothris acutipennis is a species of metallic wood-boring beetle in the family Buprestidae. It is found in Central America, North America, and South America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysobothris acutipennis has left across the world's sequence archives.

At a glance

DNA specimens44

BINs1

Marker genes1

eDNA detections89

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

28Amostly conserved

55Gvariable

58Amostly conserved

64Gmostly conserved

130Cmostly conserved

151Tmostly conserved

209Cmostly conserved

217Tmostly conserved

223Cvariable

268Cmostly conserved

280Tmostly conserved

310Tmostly conserved

340Cvariable

346Gmostly conserved

412Amostly conserved

430Amostly conserved

460Tmostly conserved

515Gmostly conserved

545Tmostly conserved

559Cmostly conserved

622Gmostly conserved

631Tmostly conserved

ATTATATTTTATTTTCGGAGCATGAGCAGGAATAGTAGGAACCGCATTAAGATTGCTAATTCGGGCAGAATTAGGGAACCCTGGAGCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes20

BIN1

Most divergent pair2.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysobothris affinissame genus12.1%Chrysobothris pusillasame genus12.6%Chrysobothris tranquebaricasame genus13.0%Pegomya fulgenssame order13.5%Chrysobothris brevitarsissame genus13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type188 records

Wild obs. + sensor66

Museum / vouchered122

Range

Area of Occupancy AOO324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 27≤1 km 15≤10 km 8>10 km 9

59 georeferenced · 7 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 8≤1 km 1≤10 km 2

11 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence122

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	94
College Station, US	15
Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record	7
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	2
Mexico City, MX	2
San Francisco, US	1
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	1

7 institutions · 122 of 122 vouchered records shown

09Environmental DNA89 detections

Where the DNA of Chrysobothris acutipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found89

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 89 detections have coordinates

Open the map1 country0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland | 1.5. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.4–26.3

Seasonal swing summer↔winter2.40 °C

Max temp (day)28.7 °C 27.4–29.6

Min temp (night)20.1 °C 19.9–24.5

Precipitation25.8 mm/mo 14.9–184

Air humidity61.4 % 60.1–66.0

Moisture balance-117 mm/mo -158–55.0

Vapour deficit1,182 Pa 1,052–1,345

Wind speed6.90 m/s 0.7–7.80

Cloud cover15.2 % 13.6–18.9

CHELSA 1981–2010, ~9 km grid, at location & month of 89 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)