Calosoma externum

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Calosoma

At a glance

Occurrence records266

Data sources7

Biological traits0

DNA specimens20

eDNA detections17

Sources7 archives

Databases and archives Calosoma externum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility266 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF266 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD20 specimens

01Narrative

Calosoma externum is a species of ground beetle in the subfamily of Carabinae. It was described by Say in 1823.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calosoma externum has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections17

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 88 variable positions, in barcode order

50Cmostly conserved

85Amostly conserved

88Amostly conserved

92Cmostly conserved

115Tmostly conserved

154Tmostly conserved

163Amostly conserved

166Amostly conserved

169Tmostly conserved

178Tmostly conserved

181Amostly conserved

187Tmostly conserved

190Tmostly conserved

199Amostly conserved

200Gmostly conserved

202Amostly conserved

206Tmostly conserved

217Gmostly conserved

229Amostly conserved

238Tmostly conserved

262Amostly conserved

263Tmostly conserved

265Amostly conserved

266Tmostly conserved

268Amostly conserved

271Tmostly conserved

274Amostly conserved

280Gmostly conserved

283Tmostly conserved

286Cmostly conserved

295Amostly conserved

301Tmostly conserved

304Amostly conserved

307Amostly conserved

313Tmostly conserved

325Tmostly conserved

337Gmostly conserved

343Tmostly conserved

346Gmostly conserved

352Amostly conserved

355Tmostly conserved

357Cmostly conserved

367Tmostly conserved

370Amostly conserved

373Amostly conserved

391Tmostly conserved

412Tmostly conserved

415Amostly conserved

424Amostly conserved

433Amostly conserved

439Tmostly conserved

463Tmostly conserved

473Amostly conserved

475Tmostly conserved

487Tmostly conserved

499Tmostly conserved

500Tmostly conserved

505Tmostly conserved

508Tmostly conserved

517Tmostly conserved

526Tmostly conserved

535Amostly conserved

538Amostly conserved

547Tmostly conserved

548Tmostly conserved

553Tmostly conserved

557Tmostly conserved

559Amostly conserved

562Tmostly conserved

571Cmostly conserved

580Tmostly conserved

586Amostly conserved

589Cmostly conserved

595Tmostly conserved

601Tmostly conserved

604Cmostly conserved

605Tmostly conserved

607Amostly conserved

616Tmostly conserved

622Tmostly conserved

628Amostly conserved

631Tmostly conserved

637Amostly conserved

646Tmostly conserved

652Cmostly conserved

653Tmostly conserved

655Amostly conserved

658Tmostly conserved

AACTTTATATTTTATTTTTGGTGCTTGATCAGGAATAGTGGGAACTTCACTAAGAATACTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes7

BINs2

Most divergent pair12.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Calosoma macrumsame genus5.5%Calosoma tepidumsame genus6.7%Calosoma lepidumsame genus6.7%Calosoma obsoletumsame genus6.8%Calosoma affinesame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type266 records

Wild obs. + sensor66

Museum / vouchered200

Range

Area of Occupancy AOO632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 30≤1 km 7≤10 km 7>10 km 11

55 georeferenced · 11 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 29≤1 km 6≤10 km 54>10 km 63

152 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence200

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lexington, US	40
Tempe, US	28
OSUClocation not on record	23
Sam Noble Oklahoma Museum of Natural Historylocation not on record	17
Provo, US	12
Zürich, CH	12
University of Alberta Museums (UAM)location not on record	10
University of Alabamalocation not on record	9
Cambridge, US	8
Colorado State Universitylocation not on record	7
University Park, US	6
EWIClocation not on record	5
ASUlocation not on record	4
Denver, US	4
Royal Saskatchewan Museumlocation not on record	3
Wuzhou, CN	2
Washington, US	1
UDlocation not on record	1
US	1
Essig Museum of Entomologylocation not on record	1
CUlocation not on record	1
NEON Biorepository at Arizona State Universitylocation not on record	1
WIlocation not on record	1
Natural History Museum of Utahlocation not on record	1
Lubbock, US	1

25 institutions · 199 of 200 vouchered records shown · 1 without an institution code

09Environmental DNA17 detections

Where the DNA of Calosoma externum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

deciduousForestpastureHaycultivatedCropsgrasslandHerbaceous

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 20.7–26.1

Seasonal swing summer↔winter27.5 °C

Max temp (day)31.2 °C 26.6–31.2

Min temp (night)21.2 °C 16.5–21.8

Precipitation117 mm/mo 79.4–145

Air humidity57.3 % 55.6–58.0

Moisture balance-70.6 mm/mo -87.9–-31.5

Vapour deficit1,432 Pa 1,060–1,443

Wind speed4.00 m/s 4.00–4.80

Cloud cover26.6 % 25.8–34.4

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)