Calosoma affine

Chaudoir, 1843 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Calosoma

At a glance

Occurrence records606

Data sources5

Biological traits0

DNA specimens54

eDNA detections50

Sources5 archives

Databases and archives Calosoma affine's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility606 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics54 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF606 records

Environmental DNA1 datasets · 1 countries50 detections

DNA & barcodingBOLD54 specimens

01Narrative

Calosoma affine is a species of ground beetle in the subfamily of Carabinae. It was described by Chaudoir in 1843.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding54 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calosoma affine has left across the world's sequence archives.

At a glance

DNA specimens54

BINs2

Marker genes1

eDNA detections50

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

50Tmostly conserved

211Gmostly conserved

217Gmostly conserved

235Tmostly conserved

290Tmostly conserved

298Cmostly conserved

301Tmostly conserved

337Tmostly conserved

343Amostly conserved

373Amostly conserved

412Tvariable

433Gvariable

475Tmostly conserved

523Cmostly conserved

550Gmostly conserved

556Avariable

634Tmostly conserved

AACTTTATATTTTATTTTTGGTGCTTGATCAGGAATAGTGGGAACTTCATTAAGAATACTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes32

BINs2

Most divergent pair4.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Calosoma lepidumsame genus3.5%Calosoma obsoletumsame genus3.6%Calosoma tepidumsame genus3.8%Calosoma reticulatumsame genus4.1%Calosoma calidumsame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type606 records

Wild obs. + sensor19

Museum / vouchered587

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 11≤1 km 4≤10 km 1

16 georeferenced · 3 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 434≤1 km 7≤10 km 57>10 km 33

531 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence587

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	460
ASUlocation not on record	40
Colorado State Universitylocation not on record	25
Provo, US	11
Albuquerque, US	7
Zürich, CH	7
University of Alberta Museums (UAM)location not on record	6
Essig Museum of Entomologylocation not on record	5
San Francisco, US	5
Santa Barbara Museum of Natural Historylocation not on record	3
College Station, US	3
NEON Biorepository at Arizona State Universitylocation not on record	3
ERWClocation not on record	2
US	2
Ciudad de México, MX	2
Lubbock, US	2
Durango, MX	1
EWIClocation not on record	1
Denver, US	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1

20 institutions · 587 of 587 vouchered records shown

09Environmental DNA50 detections

Where the DNA of Calosoma affine was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map1 country0

cultivatedCropsgrasslandHerbaceous

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 17.0–26.7

Seasonal swing summer↔winter28.1 °C

Max temp (day)31.5 °C 25.6–32.4

Min temp (night)21.1 °C 11.2–22.1

Precipitation104 mm/mo 59.3–108

Air humidity55.9 % 52.0–56.6

Moisture balance-76.1 mm/mo -102–-51.2

Vapour deficit1,459 Pa 962–1,541

Wind speed4.20 m/s 3.90–4.60

Cloud cover25.5 % 24.9–33.9

CHELSA 1981–2010, ~9 km grid, at location & month of 50 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)