Caloria quatrefagesi

(Vayssière, 1888) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Facelinidae/Caloria

At a glance

Occurrence records275

Data sources6

Biological traits2

DNA specimens6

eDNA detections7

Sources6 archives

Databases and archives Caloria quatrefagesi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility275 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF275 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD6 specimens

01Narrative

Facelina quatrefagesi is a species of sea slug, an aeolid nudibranch, a marine gastropod mollusc in the family Facelinidae.Gofas, S. (2014). Facelina quatrefagesi (Vayssière, 1888). Accessed through: World Register of Marine Species on 2015-02-14

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Caloria quatrefagesi has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P588 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

48Gvariable

159Avariable

162Gmostly conserved

291Gmostly conserved

351Gmostly conserved

396Amostly conserved

462Gmostly conserved

501Amostly conserved

GCTGGAACAGGGCTCAGGCTTTTAATTCGATTTGAGTTGGGTACAGCGGGAAGTCTCTTAGGAGATGATCATTTATATAATGTAATTGTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.53%

Haplotypes4

BIN1

Most divergent pair1.2%

OtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Caloria eleganssame genus14.8%Sakuraeolis enosimensissame family15.6%Doto dunneisame order15.6%Coryphella trilineatasame order15.8%Doto millbayanasame order15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type275 records

Wild obs. + sensor274

Museum / vouchered1

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 104≤1 km 69≤10 km 53>10 km 1

227 georeferenced · 47 without coordinates

Open the mapobservation + sensor274

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Museo Nacional de Ciencias Naturales (CSIC)location not on record	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Caloria quatrefagesi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 16.1–19.0

Seasonal swing summer↔winter10.1 °C

Max temp (day)19.3 °C 18.7–19.8

Min temp (night)15.6 °C 13.0–18.2

Precipitation30.9 mm/mo 15.5–46.4

Air humidity59.8 % 58.6–61.1

Moisture balance-93.9 mm/mo -122–-65.7

Vapour deficit829 Pa 800–859

Wind speed5.20 m/s 4.60–5.80

Cloud cover37.8 % 32.7–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)